HUGE

Gene/Protein Characteristic Table for KIAA1396

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07479
Accession No. :	AB037817
Description :	Zinc finger protein 471.
HUGO Gene Name :	zinc finger protein 471 (ZNF471)
Clone Name :	hj08221 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5041 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3384 bp

Genome contig ID gi42406306f_61627501
PolyA signal sequence
(AATAAA,-29)
+----*----+----*----+----*----+----
ACTAGAAATAAAGTCAGCATCCCATTTGACTCCTT
Flanking genome sequence
(105013 - 105062)
----+----*----+----*----+----*----+----*----+----*
ACACAGAAGTTCATTCTATACTCATTACAGATGTAAGAGGTTAAGATGGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 61721727 61732512 2 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 551 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI25223	99.6	Zinc finger pro...	Homo sapiens
Q9BX82	99.5	Zinc finger pro...	Homo sapiens
CAD38551	99.3	hypothetical pr...	Homo sapiens
CAL38280	99.1	hypothetical pr...	synthetic construct
NP_001092815	98.5	zinc finger pro...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037852	6.5e-98	61.0	KIAA1431
AB075827	1e-85	54.1	KIAA1947
AB046831	2.1e-85	59.7	KIAA1611
AB107355	4.1e-83	46.5	KIAA2033
D31763	6.5e-79	51.2	KIAA0065

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR007087 131 154 PD000003 Zinc finger

IPR007087 159 182 PD000003 Zinc finger

IPR007087 187 210 PD000003 Zinc finger

IPR007087 215 238 PD000003 Zinc finger

IPR007087 243 266 PD000003 Zinc finger

IPR007087 271 295 PD000003 Zinc finger

IPR007087 328 351 PD000003 Zinc finger

IPR007087 356 379 PD000003 Zinc finger

IPR007087 384 407 PD000003 Zinc finger

IPR007087 412 435 PD000003 Zinc finger

IPR007087 440 463 PD000003 Zinc finger

IPR007087 468 491 PD000003 Zinc finger

IPR007087 496 519 PD000003 Zinc finger

IPR007087 524 547 PD000003 Zinc finger

HMMPfam IPR007087 131 153 PF00096 Zinc finger

IPR007087 159 181 PF00096 Zinc finger

IPR007087 187 209 PF00096 Zinc finger

IPR007087 215 237 PF00096 Zinc finger

IPR007087 243 265 PF00096 Zinc finger

IPR007087 271 294 PF00096 Zinc finger

IPR007087 300 322 PF00096 Zinc finger

IPR007087 328 350 PF00096 Zinc finger

IPR007087 356 378 PF00096 Zinc finger

IPR007087 384 406 PF00096 Zinc finger

IPR007087 412 434 PF00096 Zinc finger

IPR007087 440 462 PF00096 Zinc finger

IPR007087 468 490 PF00096 Zinc finger

IPR007087 496 518 PF00096 Zinc finger

IPR007087 524 546 PF00096 Zinc finger

HMMSmart IPR015880 131 153 SM00355 Zinc finger

IPR015880 159 181 SM00355 Zinc finger

IPR015880 187 209 SM00355 Zinc finger

IPR015880 215 237 SM00355 Zinc finger

IPR015880 243 265 SM00355 Zinc finger

IPR015880 271 294 SM00355 Zinc finger

IPR015880 300 322 SM00355 Zinc finger

IPR015880 328 350 SM00355 Zinc finger

IPR015880 356 378 SM00355 Zinc finger

IPR015880 384 406 SM00355 Zinc finger

IPR015880 412 434 SM00355 Zinc finger

IPR015880 440 462 SM00355 Zinc finger

IPR015880 468 490 SM00355 Zinc finger

IPR015880 496 518 SM00355 Zinc finger

IPR015880 524 546 SM00355 Zinc finger

ProfileScan IPR007087 131 158 PS50157 Zinc finger

IPR007087 159 186 PS50157 Zinc finger

IPR007087 187 214 PS50157 Zinc finger

IPR007087 215 242 PS50157 Zinc finger

IPR007087 243 270 PS50157 Zinc finger

IPR007087 271 299 PS50157 Zinc finger

IPR007087 300 327 PS50157 Zinc finger

IPR007087 328 355 PS50157 Zinc finger

IPR007087 356 383 PS50157 Zinc finger

IPR007087 384 411 PS50157 Zinc finger

IPR007087 412 439 PS50157 Zinc finger

IPR007087 440 467 PS50157 Zinc finger

IPR007087 468 495 PS50157 Zinc finger

IPR007087 496 523 PS50157 Zinc finger

IPR007087 524 551 PS50157 Zinc finger

ScanRegExp IPR007087 133 153 PS00028 Zinc finger

IPR007087 161 181 PS00028 Zinc finger

IPR007087 189 209 PS00028 Zinc finger

IPR007087 217 237 PS00028 Zinc finger

IPR007087 245 265 PS00028 Zinc finger

IPR007087 273 294 PS00028 Zinc finger

IPR007087 302 322 PS00028 Zinc finger

IPR007087 330 350 PS00028 Zinc finger

IPR007087 358 378 PS00028 Zinc finger

IPR007087 386 406 PS00028 Zinc finger

IPR007087 414 434 PS00028 Zinc finger

IPR007087 442 462 PS00028 Zinc finger

IPR007087 470 490 PS00028 Zinc finger

IPR007087 498 518 PS00028 Zinc finger

IPR007087 526 546 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	131	154	PD000003	Zinc finger
IPR007087	159	182	PD000003	Zinc finger
IPR007087	187	210	PD000003	Zinc finger
IPR007087	215	238	PD000003	Zinc finger
IPR007087	243	266	PD000003	Zinc finger
IPR007087	271	295	PD000003	Zinc finger
IPR007087	328	351	PD000003	Zinc finger
IPR007087	356	379	PD000003	Zinc finger
IPR007087	384	407	PD000003	Zinc finger
IPR007087	412	435	PD000003	Zinc finger
IPR007087	440	463	PD000003	Zinc finger
IPR007087	468	491	PD000003	Zinc finger
IPR007087	496	519	PD000003	Zinc finger
IPR007087	524	547	PD000003	Zinc finger
HMMPfam	IPR007087	131	153	PF00096	Zinc finger
IPR007087	159	181	PF00096	Zinc finger
IPR007087	187	209	PF00096	Zinc finger
IPR007087	215	237	PF00096	Zinc finger
IPR007087	243	265	PF00096	Zinc finger
IPR007087	271	294	PF00096	Zinc finger
IPR007087	300	322	PF00096	Zinc finger
IPR007087	328	350	PF00096	Zinc finger
IPR007087	356	378	PF00096	Zinc finger
IPR007087	384	406	PF00096	Zinc finger
IPR007087	412	434	PF00096	Zinc finger
IPR007087	440	462	PF00096	Zinc finger
IPR007087	468	490	PF00096	Zinc finger
IPR007087	496	518	PF00096	Zinc finger
IPR007087	524	546	PF00096	Zinc finger
HMMSmart	IPR015880	131	153	SM00355	Zinc finger
IPR015880	159	181	SM00355	Zinc finger
IPR015880	187	209	SM00355	Zinc finger
IPR015880	215	237	SM00355	Zinc finger
IPR015880	243	265	SM00355	Zinc finger
IPR015880	271	294	SM00355	Zinc finger
IPR015880	300	322	SM00355	Zinc finger
IPR015880	328	350	SM00355	Zinc finger
IPR015880	356	378	SM00355	Zinc finger
IPR015880	384	406	SM00355	Zinc finger
IPR015880	412	434	SM00355	Zinc finger
IPR015880	440	462	SM00355	Zinc finger
IPR015880	468	490	SM00355	Zinc finger
IPR015880	496	518	SM00355	Zinc finger
IPR015880	524	546	SM00355	Zinc finger
ProfileScan	IPR007087	131	158	PS50157	Zinc finger
IPR007087	159	186	PS50157	Zinc finger
IPR007087	187	214	PS50157	Zinc finger
IPR007087	215	242	PS50157	Zinc finger
IPR007087	243	270	PS50157	Zinc finger
IPR007087	271	299	PS50157	Zinc finger
IPR007087	300	327	PS50157	Zinc finger
IPR007087	328	355	PS50157	Zinc finger
IPR007087	356	383	PS50157	Zinc finger
IPR007087	384	411	PS50157	Zinc finger
IPR007087	412	439	PS50157	Zinc finger
IPR007087	440	467	PS50157	Zinc finger
IPR007087	468	495	PS50157	Zinc finger
IPR007087	496	523	PS50157	Zinc finger
IPR007087	524	551	PS50157	Zinc finger
ScanRegExp	IPR007087	133	153	PS00028	Zinc finger
IPR007087	161	181	PS00028	Zinc finger
IPR007087	189	209	PS00028	Zinc finger
IPR007087	217	237	PS00028	Zinc finger
IPR007087	245	265	PS00028	Zinc finger
IPR007087	273	294	PS00028	Zinc finger
IPR007087	302	322	PS00028	Zinc finger
IPR007087	330	350	PS00028	Zinc finger
IPR007087	358	378	PS00028	Zinc finger
IPR007087	386	406	PS00028	Zinc finger
IPR007087	414	434	PS00028	Zinc finger
IPR007087	442	462	PS00028	Zinc finger
IPR007087	470	490	PS00028	Zinc finger
IPR007087	498	518	PS00028	Zinc finger
IPR007087	526	546	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGGGAGGTTTTGTAGAAGGTC

Primer_r
: AAGGAGTCAAATGGGATGCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGGGAGGTTTTGTAGAAGGTC
Primer_r	: AAGGAGTCAAATGGGATGCTG
PCR product length	: 135 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	3384 bp
Genome contig ID	gi42406306f_61627501
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- ACTAGAAATAAAGTCAGCATCCCATTTGACTCCTT
Flanking genome sequence (105013 - 105062)	----+--------+--------+--------+--------+----* ACACAGAAGTTCATTCTATACTCATTACAGATGTAAGAGGTTAAGATGGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	61721727	61732512	2	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1396

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information