HUGE

Gene/Protein Characteristic Table for KIAA1431

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00831
Accession No. :	AB037852
Description :	Zinc finger protein 28 homolog.
HUGO Gene Name :	zinc finger protein 28 homolog (mouse) (ZFP28)
Clone Name :	fj00022 [Vector Info]
Flexi ORF Clone :	pF1KSDA1431
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4076 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1398 bp

Genome contig ID gi42406306f_61642129
PolyA signal sequence
(AATAAA,-16)
+----*----+----*----+----*----+----
ATTGAAAAATAAAGATGTCAATAAAAGGAGAAATG
Flanking genome sequence
(117844 - 117893)
----+----*----+----*----+----*----+----*----+----*
ATATTTTTCTAGATGAAATACTCAATATTGTTAAAATGTTTGTAAATTAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 61742129 61759971 8 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 891 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_512926	98.9	zinc finger pro...	Pan troglodytes
BAG10060	100.0	zinc finger pro...	synthetic construct
Q8NHY6	99.9	Zinc finger pro...	Homo sapiens
AAI27003	99.7	Zinc finger pro...	Homo sapiens
XP_853881	85.1	similar to zinc...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037817	3.8e-73	61.0	KIAA1396
AB046831	7.5e-66	45.0	KIAA1611
D31763	4.5e-62	41.2	KIAA0065
AB075862	2e-59	51.2	KIAA1982
AB018341	1.1e-58	43.7	KIAA0798

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR007087 443 466 PD000003 Zinc finger

IPR007087 471 494 PD000003 Zinc finger

IPR007087 499 523 PD000003 Zinc finger

IPR007087 556 579 PD000003 Zinc finger

IPR007087 584 607 PD000003 Zinc finger

IPR007087 612 635 PD000003 Zinc finger

IPR007087 640 663 PD000003 Zinc finger

IPR007087 668 691 PD000003 Zinc finger

IPR007087 696 719 PD000003 Zinc finger

IPR007087 724 747 PD000003 Zinc finger

IPR007087 752 775 PD000003 Zinc finger

IPR007087 780 803 PD000003 Zinc finger

IPR007087 808 831 PD000003 Zinc finger

HMMPfam IPR001909 126 166 PF01352 KRAB box

IPR001909 255 291 PF01352 KRAB box

IPR007087 443 465 PF00096 Zinc finger

IPR007087 471 493 PF00096 Zinc finger

IPR007087 499 522 PF00096 Zinc finger

IPR007087 528 550 PF00096 Zinc finger

IPR007087 556 578 PF00096 Zinc finger

IPR007087 584 606 PF00096 Zinc finger

IPR007087 612 634 PF00096 Zinc finger

IPR007087 640 662 PF00096 Zinc finger

IPR007087 668 690 PF00096 Zinc finger

IPR007087 696 718 PF00096 Zinc finger

IPR007087 724 746 PF00096 Zinc finger

IPR007087 752 774 PF00096 Zinc finger

IPR007087 780 802 PF00096 Zinc finger

IPR007087 808 830 PF00096 Zinc finger

HMMSmart IPR001909 126 186 SM00349 KRAB box

IPR001909 255 311 SM00349 KRAB box

IPR015880 443 465 SM00355 Zinc finger

IPR015880 471 493 SM00355 Zinc finger

IPR015880 499 522 SM00355 Zinc finger

IPR015880 528 550 SM00355 Zinc finger

IPR015880 556 578 SM00355 Zinc finger

IPR015880 584 606 SM00355 Zinc finger

IPR015880 612 634 SM00355 Zinc finger

IPR015880 640 662 SM00355 Zinc finger

IPR015880 668 690 SM00355 Zinc finger

IPR015880 696 718 SM00355 Zinc finger

IPR015880 724 746 SM00355 Zinc finger

IPR015880 752 774 SM00355 Zinc finger

IPR015880 780 802 SM00355 Zinc finger

IPR015880 808 830 SM00355 Zinc finger

ProfileScan IPR001909 126 197 PS50805 KRAB box

IPR001909 255 322 PS50805 KRAB box

IPR007087 443 470 PS50157 Zinc finger

IPR007087 471 498 PS50157 Zinc finger

IPR007087 499 527 PS50157 Zinc finger

IPR007087 528 555 PS50157 Zinc finger

IPR007087 556 583 PS50157 Zinc finger

IPR007087 584 611 PS50157 Zinc finger

IPR007087 612 639 PS50157 Zinc finger

IPR007087 640 667 PS50157 Zinc finger

IPR007087 668 695 PS50157 Zinc finger

IPR007087 696 723 PS50157 Zinc finger

IPR007087 724 751 PS50157 Zinc finger

IPR007087 752 779 PS50157 Zinc finger

IPR007087 780 807 PS50157 Zinc finger

IPR007087 808 835 PS50157 Zinc finger

IPR007087 836 863 PS50157 Zinc finger

ScanRegExp IPR007087 445 465 PS00028 Zinc finger

IPR007087 473 493 PS00028 Zinc finger

IPR007087 501 522 PS00028 Zinc finger

IPR007087 530 550 PS00028 Zinc finger

IPR007087 558 578 PS00028 Zinc finger

IPR007087 586 606 PS00028 Zinc finger

IPR007087 614 634 PS00028 Zinc finger

IPR007087 642 662 PS00028 Zinc finger

IPR007087 670 690 PS00028 Zinc finger

IPR007087 698 718 PS00028 Zinc finger

IPR007087 726 746 PS00028 Zinc finger

IPR007087 754 774 PS00028 Zinc finger

IPR007087 782 802 PS00028 Zinc finger

IPR007087 810 830 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	443	466	PD000003	Zinc finger
IPR007087	471	494	PD000003	Zinc finger
IPR007087	499	523	PD000003	Zinc finger
IPR007087	556	579	PD000003	Zinc finger
IPR007087	584	607	PD000003	Zinc finger
IPR007087	612	635	PD000003	Zinc finger
IPR007087	640	663	PD000003	Zinc finger
IPR007087	668	691	PD000003	Zinc finger
IPR007087	696	719	PD000003	Zinc finger
IPR007087	724	747	PD000003	Zinc finger
IPR007087	752	775	PD000003	Zinc finger
IPR007087	780	803	PD000003	Zinc finger
IPR007087	808	831	PD000003	Zinc finger
HMMPfam	IPR001909	126	166	PF01352	KRAB box
IPR001909	255	291	PF01352	KRAB box
IPR007087	443	465	PF00096	Zinc finger
IPR007087	471	493	PF00096	Zinc finger
IPR007087	499	522	PF00096	Zinc finger
IPR007087	528	550	PF00096	Zinc finger
IPR007087	556	578	PF00096	Zinc finger
IPR007087	584	606	PF00096	Zinc finger
IPR007087	612	634	PF00096	Zinc finger
IPR007087	640	662	PF00096	Zinc finger
IPR007087	668	690	PF00096	Zinc finger
IPR007087	696	718	PF00096	Zinc finger
IPR007087	724	746	PF00096	Zinc finger
IPR007087	752	774	PF00096	Zinc finger
IPR007087	780	802	PF00096	Zinc finger
IPR007087	808	830	PF00096	Zinc finger
HMMSmart	IPR001909	126	186	SM00349	KRAB box
IPR001909	255	311	SM00349	KRAB box
IPR015880	443	465	SM00355	Zinc finger
IPR015880	471	493	SM00355	Zinc finger
IPR015880	499	522	SM00355	Zinc finger
IPR015880	528	550	SM00355	Zinc finger
IPR015880	556	578	SM00355	Zinc finger
IPR015880	584	606	SM00355	Zinc finger
IPR015880	612	634	SM00355	Zinc finger
IPR015880	640	662	SM00355	Zinc finger
IPR015880	668	690	SM00355	Zinc finger
IPR015880	696	718	SM00355	Zinc finger
IPR015880	724	746	SM00355	Zinc finger
IPR015880	752	774	SM00355	Zinc finger
IPR015880	780	802	SM00355	Zinc finger
IPR015880	808	830	SM00355	Zinc finger
ProfileScan	IPR001909	126	197	PS50805	KRAB box
IPR001909	255	322	PS50805	KRAB box
IPR007087	443	470	PS50157	Zinc finger
IPR007087	471	498	PS50157	Zinc finger
IPR007087	499	527	PS50157	Zinc finger
IPR007087	528	555	PS50157	Zinc finger
IPR007087	556	583	PS50157	Zinc finger
IPR007087	584	611	PS50157	Zinc finger
IPR007087	612	639	PS50157	Zinc finger
IPR007087	640	667	PS50157	Zinc finger
IPR007087	668	695	PS50157	Zinc finger
IPR007087	696	723	PS50157	Zinc finger
IPR007087	724	751	PS50157	Zinc finger
IPR007087	752	779	PS50157	Zinc finger
IPR007087	780	807	PS50157	Zinc finger
IPR007087	808	835	PS50157	Zinc finger
IPR007087	836	863	PS50157	Zinc finger
ScanRegExp	IPR007087	445	465	PS00028	Zinc finger
IPR007087	473	493	PS00028	Zinc finger
IPR007087	501	522	PS00028	Zinc finger
IPR007087	530	550	PS00028	Zinc finger
IPR007087	558	578	PS00028	Zinc finger
IPR007087	586	606	PS00028	Zinc finger
IPR007087	614	634	PS00028	Zinc finger
IPR007087	642	662	PS00028	Zinc finger
IPR007087	670	690	PS00028	Zinc finger
IPR007087	698	718	PS00028	Zinc finger
IPR007087	726	746	PS00028	Zinc finger
IPR007087	754	774	PS00028	Zinc finger
IPR007087	782	802	PS00028	Zinc finger
IPR007087	810	830	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCTGTGTGGAAGATCAAGGAG

Primer_r
: CATCATAATCCCAGTGTTCCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCTGTGTGGAAGATCAAGGAG
Primer_r	: CATCATAATCCCAGTGTTCCC
PCR product length	: 136 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1398 bp
Genome contig ID	gi42406306f_61642129
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- ATTGAAAAATAAAGATGTCAATAAAAGGAGAAATG
Flanking genome sequence (117844 - 117893)	----+--------+--------+--------+--------+----* ATATTTTTCTAGATGAAATACTCAATATTGTTAAAATGTTTGTAAATTAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	61742129	61759971	8	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA1431

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information