HUGE

Gene/Protein Characteristic Table for KIAA1474

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07227
Accession No. :	AB040907
Description :	Teashirt homolog 3.
HUGO Gene Name :	teashirt zinc finger homeobox 3 (TSHZ3)
Clone Name :	fj03364 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3692 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 450 bp

Genome contig ID gi42406306r_36358872
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TTTGGTTAAAAAATAAAATAAAATAATAATAATGT
Flanking genome sequence
(99971 - 99922)
----+----*----+----*----+----*----+----*----+----*
ATGAAGCTCTGTTTTTTAAACTCCTTACCAGCTTAGTTATAATGAATAAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 r 36458843 36531961 2 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 1079 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q63HK5	100.0	Teashirt homolo...	Homo sapiens
CAH56184	99.9	hypothetical pr...	Homo sapiens
BAF84155	99.8	unnamed protein...	Homo sapiens
XP_001103809	99.4	similar to teas...	Macaca mulatta
XP_512561	99.9	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007087 212 236 PF00096 Zinc finger

IPR007087 273 297 PF00096 Zinc finger

IPR001356 890 957 PF00046 Homeobox

IPR007087 1039 1062 PF00096 Zinc finger

HMMSmart IPR015880 212 236 SM00355 Zinc finger

IPR015880 273 297 SM00355 Zinc finger

IPR015880 384 408 SM00355 Zinc finger

IPR001356 888 962 SM00389 Homeobox

IPR015880 974 996 SM00355 Zinc finger

IPR015880 1039 1062 SM00355 Zinc finger

ProfileScan IPR007087 273 302 PS50157 Zinc finger

IPR001356 887 958 PS50071 Homeobox

IPR007087 1039 1067 PS50157 Zinc finger

ScanRegExp IPR007087 214 236 PS00028 Zinc finger

IPR007087 275 297 PS00028 Zinc finger

IPR007087 976 996 PS00028 Zinc finger

IPR007087 1041 1062 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	212	236	PF00096	Zinc finger
IPR007087	273	297	PF00096	Zinc finger
IPR001356	890	957	PF00046	Homeobox
IPR007087	1039	1062	PF00096	Zinc finger
HMMSmart	IPR015880	212	236	SM00355	Zinc finger
IPR015880	273	297	SM00355	Zinc finger
IPR015880	384	408	SM00355	Zinc finger
IPR001356	888	962	SM00389	Homeobox
IPR015880	974	996	SM00355	Zinc finger
IPR015880	1039	1062	SM00355	Zinc finger
ProfileScan	IPR007087	273	302	PS50157	Zinc finger
IPR001356	887	958	PS50071	Homeobox
IPR007087	1039	1067	PS50157	Zinc finger
ScanRegExp	IPR007087	214	236	PS00028	Zinc finger
IPR007087	275	297	PS00028	Zinc finger
IPR007087	976	996	PS00028	Zinc finger
IPR007087	1041	1062	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCCAATACACCTGCCAGCATC

Primer_r
: GGTATTTGGAAGAGATGTCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCCAATACACCTGCCAGCATC
Primer_r	: GGTATTTGGAAGAGATGTCAC
PCR product length	: 148 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	450 bp
Genome contig ID	gi42406306r_36358872
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TTTGGTTAAAAAATAAAATAAAATAATAATAATGT
Flanking genome sequence (99971 - 99922)	----+--------+--------+--------+--------+----* ATGAAGCTCTGTTTTTTAAACTCCTTACCAGCTTAGTTATAATGAATAAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	r	36458843	36531961	2	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1474

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information