HUGE

Gene/Protein Characteristic Table for KIAA1486

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00849
Accession No. :	AB040919
Description :
HUGO Gene Name :
Clone Name :	fj07162 [Vector Info]
Flexi ORF Clone :	pF1KSDA1486
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4498 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2453 bp

Genome contig ID gi89161199f_225881823
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTCCAGCCTGGGTGACAGAGCGAGACTCCATCTC
Flanking genome sequence
(345157 - 345206)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAGAAAAAGAAAAAAAAACTTATTAAAAGTCCTTTTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 225973935 226226978 6 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 677 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001099979	3e-203	98.2	similar to myos...	Macaca mulatta
NP_065915	5.3e-199	99.8	hypothetical pr...	Homo sapiens
EAW70836	8.4e-199	100.0	hCG1811893 [Hom...	Homo sapiens
BAC33918	1.3e-182	91.6	unnamed protein...	Mus musculus
XP_237329	6.5e-179	91.6	similar to myos...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020672	6.3e-21	43.4	KIAA0865

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGTTCAGAGCCTAAAGTAAGC

Primer_r
: ACGATTGGCTAACGATGATGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GTTGCTCTGATGTTCGTTTGG
Primer_r	: TCCAGAATGACACCACCCTAC
PCR product length	: 187 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2453 bp
Genome contig ID	gi89161199f_225881823
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTGGGTGACAGAGCGAGACTCCATCTC
Flanking genome sequence (345157 - 345206)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAGAAAAAGAAAAAAAAACTTATTAAAAGTCCTTTTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	225973935	226226978	6	99.3	Perfect prediction

Primer_f	: AGTTCAGAGCCTAAAGTAAGC
Primer_r	: ACGATTGGCTAACGATGATGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1486

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information