HUGE |
Gene/Protein Characteristic Table for KIAA1495 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00851 |
---|---|
Accession No. : | AB040928 |
Description : | Leucine-rich repeat and calponin homology domain-containing protein 2. |
HUGO Gene Name : | leucine-rich repeats and calponin homology (CH) domain containing 2 (LRCH2) |
Clone Name : | fj08986 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1495
![]() |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4105 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2595 bp Genome contig ID gi89161218r_114151441 PolyA signal sequence
(GATAAA,-14) +----*----+----*----+----*----+----
ATATTACCGATGCAAACTGTGGATAAAGTTGAAAGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAAAATTTAAGTCTGGTATTTCTTTTCTCCCTCTCTACCTCCTTTCTTA
Features of the protein sequence |
Description | |
---|---|---|
Length: 502 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GAAAATACAGCAGAACCTCAC | |
: ACATCAGAGCCTTGGTATAAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: X |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |