HUGE

Gene/Protein Characteristic Table for KIAA1495

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00851
Accession No. :	AB040928
Description :	Leucine-rich repeat and calponin homology domain-containing protein 2.
HUGO Gene Name :	leucine-rich repeats and calponin homology (CH) domain containing 2 (LRCH2)
Clone Name :	fj08986 [Vector Info]
Flexi ORF Clone :	pF1KSDA1495
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4105 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2595 bp

Genome contig ID gi89161218r_114151441
PolyA signal sequence
(GATAAA,-14)
+----*----+----*----+----*----+----
ATATTACCGATGCAAACTGTGGATAAAGTTGAAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAATTTAAGTCTGGTATTTCTTTTCTCCCTCTCTACCTCCTTTCTTA

Features of the protein sequence	Description

Length: 502 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAX02618	2.4e-187	100.0	leucine-rich re...	Homo sapiens
Q5VUJ6	2.9e-187	100.0	Leucine-rich re...	Homo sapiens
CAH70721	2.7e-186	99.2	leucine-rich re...	Homo sapiens
XP_001102903	2.1e-185	99.0	similar to leuc...	Macaca mulatta
XP_549199	1.9e-178	95.6	similar to leuc...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023233	1.3e-20	41.0	KIAA1016

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001715 380 493 PF00307 Calponin-like actin-binding

HMMSmart IPR001715 385 488 SM00033 Calponin-like actin-binding

ProfileScan IPR001715 379 492 PS50021 Calponin-like actin-binding

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001715	380	493	PF00307	Calponin-like actin-binding
HMMSmart	IPR001715	385	488	SM00033	Calponin-like actin-binding
ProfileScan	IPR001715	379	492	PS50021	Calponin-like actin-binding

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GAAAATACAGCAGAACCTCAC

Primer_r
: ACATCAGAGCCTTGGTATAAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: X

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2595 bp
Genome contig ID	gi89161218r_114151441
PolyA signal sequence (GATAAA,-14)	+--------+--------+----*----+---- ATATTACCGATGCAAACTGTGGATAAAGTTGAAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAATTTAAGTCTGGTATTTCTTTTCTCCCTCTCTACCTCCTTTCTTA

Primer_f	: GAAAATACAGCAGAACCTCAC
Primer_r	: ACATCAGAGCCTTGGTATAAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1495

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information