HUGE |
Gene/Protein Characteristic Table for KIAA1016 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00166 |
---|---|
Accession No. : | AB023233 |
Description : | Leucine-rich repeat and calponin homology domain-containing protein 1. |
HUGO Gene Name : | leucine-rich repeats and calponin homology (CH) domain containing 1 (LRCH1) |
Clone Name : | hk03719s1 [Vector Info] |
Flexi ORF Clone : | pF1KA1016
![]() |
Source : | Human adult brain |
Note : | We replaced hk03719, former representative clones for KIAA1016 with hk03719s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4131 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1747 bp Genome contig ID gi51511729f_45925336 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
CCATAAATTGCTTAATAAACACATTTTGGGTGATTFlanking genome sequence
(290397 - 290446) ----+----*----+----*----+----*----+----*----+----*
ATTCCAAGTTTTTATCAGCCCATTGATACATGTATTCATGAGCTCTCAGC
Chr f/r start end exon identity class ContigView(URL based/DAS) 13 f 46025336 46215731 19 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 793 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GCAGGGTATGTGGAAGTTATC | |
: CAGGGTGCTCATTAGACATCG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 13 |
: GeneBridge 4 | |
: GCAGGGTATGTGGAAGTTATC | |
: CAGGGTGCTCATTAGACATCG | |
: 143 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |