HUGE

Gene/Protein Characteristic Table for KIAA1016

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00166
Accession No. :	AB023233
Description :	Leucine-rich repeat and calponin homology domain-containing protein 1.
HUGO Gene Name :	leucine-rich repeats and calponin homology (CH) domain containing 1 (LRCH1)
Clone Name :	hk03719s1 [Vector Info]
Flexi ORF Clone :	pF1KA1016
Source :	Human adult brain
Note :	We replaced hk03719, former representative clones for KIAA1016 with hk03719s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4131 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1747 bp

Genome contig ID gi51511729f_45925336
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
CCATAAATTGCTTAATAAACACATTTTGGGTGATT
Flanking genome sequence
(290397 - 290446)
----+----*----+----*----+----*----+----*----+----*
ATTCCAAGTTTTTATCAGCCCATTGATACATGTATTCATGAGCTCTCAGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 13 f 46025336 46215731 19 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 793 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y2L9	100.0	Leucine-rich re...	Homo sapiens
CAH73642	99.0	leucine-rich re...	Homo sapiens
CAH92381	98.4	hypothetical pr...	Pongo abelii
XP_001915067	93.2	leucine-rich re...	Equus caballus
AAK95567	99.1	neuronal protei...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040928	1.5e-18	41.0	KIAA1495
AB020669	2e-06	35.1	KIAA0862
AB033051	2.6e-06	23.0	KIAA1225
D63481	1.9e-05	31.0	KIAA0147
AB037858	6.8e-05	30.4	KIAA1437

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 210 223 PR00019 Leucine-rich repeat

IPR001611 252 265 PR00019 Leucine-rich repeat

HMMPfam IPR001611 186 207 PF00560 Leucine-rich repeat

IPR001611 209 230 PF00560 Leucine-rich repeat

IPR001611 231 252 PF00560 Leucine-rich repeat

IPR001611 254 275 PF00560 Leucine-rich repeat

IPR001611 277 298 PF00560 Leucine-rich repeat

IPR001715 642 757 PF00307 Calponin-like actin-binding

HMMSmart IPR003591 184 206 SM00369 Leucine-rich repeat

NULL 207 226 SM00364 NULL

IPR003591 207 230 SM00369 Leucine-rich repeat

NULL 232 248 SM00364 NULL

IPR003591 252 274 SM00369 Leucine-rich repeat

NULL 252 271 SM00364 NULL

NULL 275 294 SM00364 NULL

IPR003591 275 298 SM00369 Leucine-rich repeat

IPR003591 320 343 SM00369 Leucine-rich repeat

IPR001715 643 752 SM00033 Calponin-like actin-binding

ProfileScan IPR001715 641 754 PS50021 Calponin-like actin-binding

ScanRegExp IPR002114 534 549 PS00589 Phosphotransferase system

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	210	223	PR00019	Leucine-rich repeat
IPR001611	252	265	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	186	207	PF00560	Leucine-rich repeat
IPR001611	209	230	PF00560	Leucine-rich repeat
IPR001611	231	252	PF00560	Leucine-rich repeat
IPR001611	254	275	PF00560	Leucine-rich repeat
IPR001611	277	298	PF00560	Leucine-rich repeat
IPR001715	642	757	PF00307	Calponin-like actin-binding
HMMSmart	IPR003591	184	206	SM00369	Leucine-rich repeat
NULL	207	226	SM00364	NULL
IPR003591	207	230	SM00369	Leucine-rich repeat
NULL	232	248	SM00364	NULL
IPR003591	252	274	SM00369	Leucine-rich repeat
NULL	252	271	SM00364	NULL
NULL	275	294	SM00364	NULL
IPR003591	275	298	SM00369	Leucine-rich repeat
IPR003591	320	343	SM00369	Leucine-rich repeat
IPR001715	643	752	SM00033	Calponin-like actin-binding
ProfileScan	IPR001715	641	754	PS50021	Calponin-like actin-binding
ScanRegExp	IPR002114	534	549	PS00589	Phosphotransferase system

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 767 DLIGFCLVHILFIVLVYITYHWN 789 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	767	DLIGFCLVHILFIVLVYITYHWN	789	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCAGGGTATGTGGAAGTTATC

Primer_r
: CAGGGTGCTCATTAGACATCG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 13

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCAGGGTATGTGGAAGTTATC
Primer_r	: CAGGGTGCTCATTAGACATCG
PCR product length	: 143 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1747 bp
Genome contig ID	gi51511729f_45925336
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CCATAAATTGCTTAATAAACACATTTTGGGTGATT
Flanking genome sequence (290397 - 290446)	----+--------+--------+--------+--------+----* ATTCCAAGTTTTTATCAGCCCATTGATACATGTATTCATGAGCTCTCAGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	13	f	46025336	46215731	19	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA1016

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information