| HUGE | 
| Gene/Protein Characteristic Table for KIAA1500 | 
| Link to : 
Rouge | 
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Mapping | |
| Product ID : | ORK05229 | 
|---|---|
| Accession No. : | AB040933 | 
| Description : | Extracellular matrix protein FRAS1 precursor. | 
| HUGO Gene Name : | Fraser syndrome 1 (FRAS1) | 
| Clone Name : | hh12031s1 [Vector Info] | 
| Source : | Human adult brain | 
| Note : | We replaced hh12031, former representative clones for KIAA1500 with hh12031s1. (2003/4/2) | 
| Features of the cloned DNA sequence | Description | |
|---|---|---|
Length: 9853 bp
|   | 
| cloned DNA seq. | |
| Warning for N-terminal truncation: | YES | 
| Warning for coding interruption: | NO | 
Length of 3'UTR 3129 bp Genome contig ID gi89161207f_79478846 PolyA signal sequence 
(AATAAA,-8)
GTATATGCCACTATATAAATTTGTATTAATAAATGFlanking genome sequence 
(205587 - 205636)
ACAGTCTTGTTGGTTTTTTGTTTGTTTTCCTATGTTCTTTTTAGATTATA
Chr f/r start end exon identity class ContigView(URL based/DAS) 4 f 79578846 79684431 36 99.5 Perfect prediction 
| Features of the protein sequence | Description | |
|---|---|---|
Length: 2240 aa
|  | 
 | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|  | 
 | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 
    | RH mapping information | Description | |
|---|---|---|
| : 4 | 
| : unigene | |
| : - | |
| : - | |
| : - | |
| : - | 
| How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage   | |