HUGE

Gene/Protein Characteristic Table for KIAA1500

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK05229
Accession No. :	AB040933
Description :	Extracellular matrix protein FRAS1 precursor.
HUGO Gene Name :	Fraser syndrome 1 (FRAS1)
Clone Name :	hh12031s1 [Vector Info]
Source :	Human adult brain
Note :	We replaced hh12031, former representative clones for KIAA1500 with hh12031s1. (2003/4/2)

Features of the cloned DNA sequence	Description

Length: 9853 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3129 bp

Genome contig ID gi89161207f_79478846
PolyA signal sequence
(AATAAA,-8)
+----*----+----*----+----*----+----
GTATATGCCACTATATAAATTTGTATTAATAAATG
Flanking genome sequence
(205587 - 205636)
----+----*----+----*----+----*----+----*----+----*
ACAGTCTTGTTGGTTTTTTGTTTGTTTTCCTATGTTCTTTTTAGATTATA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 f 79578846 79684431 36 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 2240 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX05821	99.9	Fraser syndrome...	Homo sapiens
NP_079350	99.8	Fraser syndrome...	Homo sapiens
Q86XX4	99.5	Extracellular m...	Homo sapiens
XP_517202	99.3	Fraser syndrome...	Pan troglodytes
XP_001492196	93.3	similar to Fras...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075823	9.5e-06	22.0	KIAA1943
AB029010	0.00011	27.3	KIAA1087

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003644 783 878 PF03160 Na-Ca exchanger/integrin-beta4

IPR003644 891 1002 PF03160 Na-Ca exchanger/integrin-beta4

IPR003644 1016 1108 PF03160 Na-Ca exchanger/integrin-beta4

IPR003644 1137 1239 PF03160 Na-Ca exchanger/integrin-beta4

IPR003644 1257 1361 PF03160 Na-Ca exchanger/integrin-beta4

HMMSmart IPR003644 770 878 SM00237 Na-Ca exchanger/integrin-beta4

IPR003644 891 1002 SM00237 Na-Ca exchanger/integrin-beta4

IPR003644 1017 1122 SM00237 Na-Ca exchanger/integrin-beta4

IPR003644 1137 1239 SM00237 Na-Ca exchanger/integrin-beta4

IPR003644 1257 1361 SM00237 Na-Ca exchanger/integrin-beta4

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003644	783	878	PF03160	Na-Ca exchanger/integrin-beta4
IPR003644	891	1002	PF03160	Na-Ca exchanger/integrin-beta4
IPR003644	1016	1108	PF03160	Na-Ca exchanger/integrin-beta4
IPR003644	1137	1239	PF03160	Na-Ca exchanger/integrin-beta4
IPR003644	1257	1361	PF03160	Na-Ca exchanger/integrin-beta4
HMMSmart	IPR003644	770	878	SM00237	Na-Ca exchanger/integrin-beta4
IPR003644	891	1002	SM00237	Na-Ca exchanger/integrin-beta4
IPR003644	1017	1122	SM00237	Na-Ca exchanger/integrin-beta4
IPR003644	1137	1239	SM00237	Na-Ca exchanger/integrin-beta4
IPR003644	1257	1361	SM00237	Na-Ca exchanger/integrin-beta4

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 2134 IGSALAAIMLLLLVFLVACFIN 2155 PRIMARY 22

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	2134	IGSALAAIMLLLLVFLVACFIN	2155	PRIMARY	22

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3129 bp
Genome contig ID	gi89161207f_79478846
PolyA signal sequence (AATAAA,-8)	+--------+--------+----*----+---- GTATATGCCACTATATAAATTTGTATTAATAAATG
Flanking genome sequence (205587 - 205636)	----+--------+--------+--------+--------+----* ACAGTCTTGTTGGTTTTTTGTTTGTTTTCCTATGTTCTTTTTAGATTATA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	f	79578846	79684431	36	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA1500

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information