HUGE |
Gene/Protein Characteristic Table for KIAA1500 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK05229 |
---|---|
Accession No. : | AB040933 |
Description : | Extracellular matrix protein FRAS1 precursor. |
HUGO Gene Name : | Fraser syndrome 1 (FRAS1) |
Clone Name : | hh12031s1 [Vector Info] |
Source : | Human adult brain |
Note : | We replaced hh12031, former representative clones for KIAA1500 with hh12031s1. (2003/4/2) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 9853 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3129 bp Genome contig ID gi89161207f_79478846 PolyA signal sequence
(AATAAA,-8) +----*----+----*----+----*----+----
GTATATGCCACTATATAAATTTGTATTAATAAATGFlanking genome sequence
(205587 - 205636) ----+----*----+----*----+----*----+----*----+----*
ACAGTCTTGTTGGTTTTTTGTTTGTTTTCCTATGTTCTTTTTAGATTATA
Chr f/r start end exon identity class ContigView(URL based/DAS) 4 f 79578846 79684431 36 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 2240 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 4 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |