HUGE

Gene/Protein Characteristic Table for KIAA1515

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB040948
Description :	Ubiquitin carboxyl-terminal hydrolase 28.
HUGO Gene Name :	ubiquitin specific peptidase 28 (USP28)
Clone Name :	fh04655 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5313 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
NO NO

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 1148 bp

Genome contig ID gi51511727r_113074024
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTTTGCCCTTAAAAGTAAGGGATGTGGGTTTGTAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAAACCAGCATACATATGCAAAACTATAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 r 113174024 113205399 15 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 757 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW67233	100.0	ubiquitin speci...	Homo sapiens
BAG65525	100.0	unnamed protein...	Homo sapiens
EAW67234	100.0	ubiquitin speci...	Homo sapiens
ACA06099	100.0	ubiquitin carbo...	Homo sapiens
BAC34993	89.2	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001394 1 359 PF00443 Peptidase C19

ProfileScan IPR001394 68 363 PS50235 Peptidase C19

ScanRegExp IPR001394 296 313 PS00973 Peptidase C19

IPR005479 633 640 PS00867 Carbamoyl-phosphate synthase L chain

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001394	1	359	PF00443	Peptidase C19
ProfileScan	IPR001394	68	363	PS50235	Peptidase C19
ScanRegExp	IPR001394	296	313	PS00973	Peptidase C19
IPR005479	633	640	PS00867	Carbamoyl-phosphate synthase L chain

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AAGTTCGTTGTCATAGTGCTC

Primer_r
: TCTTCTGGCGTAATTCAACAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CATTTCTAACCAGCTATCAGG
Primer_r	: AGGATACTGGCCGAAGGTCTC
PCR product length	: 160 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	NO	NO
Warning for coding interruption:	YES	NO

Length of 3'UTR	1148 bp
Genome contig ID	gi51511727r_113074024
PolyA signal sequence (None)	+--------+--------+----*----+---- TTTTGCCCTTAAAAGTAAGGGATGTGGGTTTGTAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAACCAGCATACATATGCAAAACTATAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	r	113174024	113205399	15	99.6	Perfect prediction

Primer_f	: AAGTTCGTTGTCATAGTGCTC
Primer_r	: TCTTCTGGCGTAATTCAACAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1515

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information