| HUGE |
Gene/Protein Characteristic Table for KIAA1518 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | |
| Product ID : | ORK05563 |
|---|---|
| Accession No. : | AB040951 |
| Description : | Ankyrin repeat domain-containing protein 25. |
| HUGO Gene Name : | KN motif and ankyrin repeat domains 2 (KANK2) |
| Clone Name : | sh00483 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA1518
|
| Source : | |
| Note : | We replaced fh12339, former representative clones for KIAA1518 with sh00483. (2001/2/22) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5156 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2287 bp Genome contig ID gi42406306r_11035947 PolyA signal sequence
(AATAAA,-22)
GGTAAACAAATTTAATAAAGCTACCAATAATGTTGFlanking genome sequence
(100000 - 99951)
ATGATTCTGTGTCTTTTCTTTTTTCGCTGTGCTCCCTTTTAAGCTTTAAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 19 r 11135947 11167485 13 98.8 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 876 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
