HUGE

Gene/Protein Characteristic Table for KIAA0172

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00443
Accession No. :	D79994
Description :	Ankyrin repeat domain-containing protein 15.
HUGO Gene Name :	KN motif and ankyrin repeat domains 4 (KANK4)
Clone Name :	ha02512s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0172
Source :	Myeloblast cell line (KG-1)
Note :	We replaced ha02512, former representative clones for KIAA0172 with ha02512s1. (2003/1/10)

Features of the cloned DNA sequence	Description

Length: 5635 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 868 bp

Genome contig ID gi89161216f_439105
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TGCCATATTTTCAAAATAAAATTCCATTAAGCTCT
Flanking genome sequence
(297000 - 297049)
----+----*----+----*----+----*----+----*----+----*
TTTCCTTGTCCCTGTTTCATCTCTGATAGCTGTCCGCCCCGAGCCGATTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 f 539101 736103 12 99.2 Terminal No-hit

Features of the protein sequence	Description

Length: 1366 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09638	100.0	ankyrin repeat ...	synthetic construct
Q14678	99.9	KN motif and an...	Homo sapiens
EAW58821	99.9	ankyrin repeat ...	Homo sapiens
AAH37495	99.8	KANK1 protein [...	Homo sapiens
BAF85678	99.6	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040951	2.2e-32	44.6	KIAA1518
AB033049	0.00036	33.7	KIAA1223
AB002377	0.0007	31.7	KIAA0379

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002110 1281 1293 PR01415 Ankyrin

IPR002110 1293 1305 PR01415 Ankyrin

HMMPfam IPR002110 1175 1205 PF00023 Ankyrin

IPR002110 1209 1245 PF00023 Ankyrin

IPR002110 1247 1279 PF00023 Ankyrin

IPR002110 1280 1313 PF00023 Ankyrin

IPR002110 1314 1334 PF00023 Ankyrin

HMMSmart IPR002110 971 1001 SM00248 Ankyrin

IPR002110 1175 1205 SM00248 Ankyrin

IPR002110 1209 1242 SM00248 Ankyrin

IPR002110 1247 1276 SM00248 Ankyrin

IPR002110 1280 1312 SM00248 Ankyrin

IPR002110 1314 1342 SM00248 Ankyrin

ProfileScan IPR002110 1169 1334 PS50297 Ankyrin

IPR002110 1175 1197 PS50088 Ankyrin

IPR002110 1247 1279 PS50088 Ankyrin

IPR002110 1280 1301 PS50088 Ankyrin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	1281	1293	PR01415	Ankyrin
IPR002110	1293	1305	PR01415	Ankyrin
HMMPfam	IPR002110	1175	1205	PF00023	Ankyrin
IPR002110	1209	1245	PF00023	Ankyrin
IPR002110	1247	1279	PF00023	Ankyrin
IPR002110	1280	1313	PF00023	Ankyrin
IPR002110	1314	1334	PF00023	Ankyrin
HMMSmart	IPR002110	971	1001	SM00248	Ankyrin
IPR002110	1175	1205	SM00248	Ankyrin
IPR002110	1209	1242	SM00248	Ankyrin
IPR002110	1247	1276	SM00248	Ankyrin
IPR002110	1280	1312	SM00248	Ankyrin
IPR002110	1314	1342	SM00248	Ankyrin
ProfileScan	IPR002110	1169	1334	PS50297	Ankyrin
IPR002110	1175	1197	PS50088	Ankyrin
IPR002110	1247	1279	PS50088	Ankyrin
IPR002110	1280	1301	PS50088	Ankyrin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: AAGGTTGGATTGTGTTAGAGG
Primer_r	: GAGGACCAAAGTAAATGTGAC
PCR product length	: 111 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	868 bp
Genome contig ID	gi89161216f_439105
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGCCATATTTTCAAAATAAAATTCCATTAAGCTCT
Flanking genome sequence (297000 - 297049)	----+--------+--------+--------+--------+----* TTTCCTTGTCCCTGTTTCATCTCTGATAGCTGTCCGCCCCGAGCCGATTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	f	539101	736103	12	99.2	Terminal No-hit

Gene/Protein Characteristic Table for KIAA0172

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information