HUGE |
Gene/Protein Characteristic Table for KIAA0172 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00443 |
---|---|
Accession No. : | D79994 |
Description : | Ankyrin repeat domain-containing protein 15. |
HUGO Gene Name : | KN motif and ankyrin repeat domains 4 (KANK4) |
Clone Name : | ha02512s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0172
![]() |
Source : | Myeloblast cell line (KG-1) |
Note : | We replaced ha02512, former representative clones for KIAA0172 with ha02512s1. (2003/1/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5635 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 868 bp Genome contig ID gi89161216f_439105 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
TGCCATATTTTCAAAATAAAATTCCATTAAGCTCTFlanking genome sequence
(297000 - 297049) ----+----*----+----*----+----*----+----*----+----*
TTTCCTTGTCCCTGTTTCATCTCTGATAGCTGTCCGCCCCGAGCCGATTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 9 f 539101 736103 12 99.2 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 1366 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 20 |
: Genebridge 4 | |
: AAGGTTGGATTGTGTTAGAGG | |
: GAGGACCAAAGTAAATGTGAC | |
: 111 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |