HUGE

Gene/Protein Characteristic Table for KIAA1545

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04238
Accession No. :	AB046765
Description :	XTP9.
HUGO Gene Name :	fibrosin-like 1 (FBRSL1)
Clone Name :	fj14026s1 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fj14026, former representative clones for KIAA1545 with fj14026s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4307 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1398 bp

Genome contig ID gi89161190f_131477459
PolyA signal sequence
(GATAAA,-25)
+----*----+----*----+----*----+----
AATCAGTGACGATAAATACAGCCTTGATTTGGATG
Flanking genome sequence
(194387 - 194436)
----+----*----+----*----+----*----+----*----+----*
AAACTGTGGTCGCGTGTTCTGTGGTGTTGGGGGGCCAGGCTCACCCAGGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 131577459 131671844 17 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 968 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9HCM7	0	99.9	AUTS2-like prot...	Homo sapiens
NP_001136113	0	99.9	fibrosin-like 1...	Homo sapiens
AAO85466	2.9e-201	99.8	XTP9 [Homo sapi...	Homo sapiens
XP_001253535	4.5e-60	60.8	similar to RIKE...	Bos taurus
XP_001378040	1.3e-59	45.9	similar to auti...	Monodelphis dom...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007902	4e-14	38.4	KIAA0442

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom NULL 517 717 PD360677 NULL

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	517	717	PD360677	NULL

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCGGCTTTTCTGAGGGTGATC

Primer_r
: TGCAAATCCCAACCGAAAACG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1398 bp
Genome contig ID	gi89161190f_131477459
PolyA signal sequence (GATAAA,-25)	+--------+--------+----*----+---- AATCAGTGACGATAAATACAGCCTTGATTTGGATG
Flanking genome sequence (194387 - 194436)	----+--------+--------+--------+--------+----* AAACTGTGGTCGCGTGTTCTGTGGTGTTGGGGGGCCAGGCTCACCCAGGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	131577459	131671844	17	99.5	Perfect prediction

Primer_f	: TCGGCTTTTCTGAGGGTGATC
Primer_r	: TGCAAATCCCAACCGAAAACG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1545

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information