HUGE |
Gene/Protein Characteristic Table for KIAA1545 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04238 |
---|---|
Accession No. : | AB046765 |
Description : | XTP9. |
HUGO Gene Name : | fibrosin-like 1 (FBRSL1) |
Clone Name : | fj14026s1 [Vector Info] |
Source : | Human fetal brain |
Note : | We replaced fj14026, former representative clones for KIAA1545 with fj14026s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4307 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1398 bp Genome contig ID gi89161190f_131477459 PolyA signal sequence
(GATAAA,-25) +----*----+----*----+----*----+----
AATCAGTGACGATAAATACAGCCTTGATTTGGATGFlanking genome sequence
(194387 - 194436) ----+----*----+----*----+----*----+----*----+----*
AAACTGTGGTCGCGTGTTCTGTGGTGTTGGGGGGCCAGGCTCACCCAGGC
Chr f/r start end exon identity class ContigView(URL based/DAS) 12 f 131577459 131671844 17 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 968 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TCGGCTTTTCTGAGGGTGATC | |
: TGCAAATCCCAACCGAAAACG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 12 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |