HUGE |
Gene/Protein Characteristic Table for KIAA0442 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04237 |
---|---|
Accession No. : | AB007902 |
Description : | Autism susceptibility gene 2 protein. |
HUGO Gene Name : | autism susceptibility candidate 2 (AUTS2) |
Clone Name : | hh03913 [Vector Info] |
Source : | Human adult brain |
Note : | We replaced hh00712, former representative clones for KIAA0442 with hh03913. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5495 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1491 bp Genome contig ID gi89161213f_68602280 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TAAAGTGCTATCTGACGTTGTTATCCTGTTTTTGCFlanking genome sequence
(1293131 - 1293180) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAGTTAACTACAGACCATTGTTTCTAATAAGC
Chr f/r start end exon identity class ContigView(URL based/DAS) 7 f 68702280 69895409 16 100.0 Internal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 1266 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GGAAGAAGAAACCCTAGGCAG | |
: ATGACTGGGCTAAAAGATCTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 7 |
: GeneBridge 4 | |
: CATTACACAAGAAGGCTCCGC | |
: GTTCTATACGGACCTTTTTGC | |
: 128 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |