HUGE

Gene/Protein Characteristic Table for KIAA1557

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04169
Accession No. :	AB046777
Description :	AT-rich interactive domain-containing protein 2.
HUGO Gene Name :	AT rich interactive domain 2 (ARID, RFX-like) (ARID2)
Clone Name :	fh18848 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5379 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2958 bp

Genome contig ID gi89161190f_44431261
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
AACCATGAAATGACAATAAAATGATTTTTAAAATG
Flanking genome sequence
(156827 - 156876)
----+----*----+----*----+----*----+----*----+----*
AGAATGTTTTGGATAAGTGACTTCTGTCCTGATCTTAACCACTGCTGTTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 44531261 44588086 7 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 806 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH90062	100.0	ARID2 protein [...	Homo sapiens
Q68CP9	100.0	AT-rich interac...	Homo sapiens
AAZ74794	100.0	zipzap protein ...	Homo sapiens
BAC87171	99.9	unnamed protein...	Homo sapiens
CAD97878	99.5	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ScanRegExp IPR007087 605 628 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR007087	605	628	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTTGTGGAATTTATGCTTGGC

Primer_r
: ATGATGTCAACTACCAGGTGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2958 bp
Genome contig ID	gi89161190f_44431261
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AACCATGAAATGACAATAAAATGATTTTTAAAATG
Flanking genome sequence (156827 - 156876)	----+--------+--------+--------+--------+----* AGAATGTTTTGGATAAGTGACTTCTGTCCTGATCTTAACCACTGCTGTTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	44531261	44588086	7	100.0	Perfect prediction

Primer_f	: GTTGTGGAATTTATGCTTGGC
Primer_r	: ATGATGTCAACTACCAGGTGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1557

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information