HUGE

Gene/Protein Characteristic Table for KIAA1563

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00865
Accession No. :	AB046783
Description :	Alsin.
HUGO Gene Name :
Clone Name :	fh20460s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA1563
Source :	Human fetal brain
Note :	We replaced fh20460, former representative clones for KIAA1563 with fh20460s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6348 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1297 bp

Genome contig ID gi89161199r_202173522
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
AACAGCAATTTTCATAATAAAAGGCATTCATCTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGTGGTTGTTTTATGATTGTAGAAGAAATGAACAGGGCAGCCTAAAAGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 202273522 202341919 33 99.8 Terminal No-hit

Features of the protein sequence	Description

Length: 1658 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96Q42	100.0	Alsin; Amyotrop...	Homo sapiens
NP_065970	99.9	alsin isoform 1...	Homo sapiens
Q5BIW4	99.8	Alsin; Amyotrop...	Pan troglodytes
AAL14103	99.9	alsin [Homo sap...	Homo sapiens
EAW70291	99.6	amyotrophic lat...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D25215	3.4e-10	35.6	KIAA0032
AB040903	7.7e-08	28.3	KIAA1470
AB046813	7.4e-06	32.4	KIAA1593
AB037838	0.00011	30.7	KIAA1417

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000408 528 544 PR00633 Regulator of chromosome condensation

IPR000408 562 575 PR00633 Regulator of chromosome condensation

IPR000408 581 597 PR00633 Regulator of chromosome condensation

HMMPfam IPR003409 1050 1072 PF02493 MORN motif

IPR003409 1073 1095 PF02493 MORN motif

IPR003409 1101 1123 PF02493 MORN motif

IPR003409 1124 1146 PF02493 MORN motif

IPR003409 1152 1174 PF02493 MORN motif

IPR003409 1176 1198 PF02493 MORN motif

IPR003409 1199 1221 PF02493 MORN motif

IPR003409 1222 1245 PF02493 MORN motif

IPR003123 1553 1657 PF02204 Vacuolar sorting protein 9

HMMSmart IPR003409 1048 1069 SM00698 MORN motif

IPR003409 1071 1092 SM00698 MORN motif

IPR003409 1099 1120 SM00698 MORN motif

IPR003409 1122 1143 SM00698 MORN motif

IPR003409 1150 1171 SM00698 MORN motif

IPR003409 1174 1195 SM00698 MORN motif

IPR003409 1197 1218 SM00698 MORN motif

IPR003409 1220 1242 SM00698 MORN motif

ProfileScan IPR000408 61 110 PS50012 Regulator of chromosome condensation

IPR000408 111 169 PS50012 Regulator of chromosome condensation

IPR000408 170 220 PS50012 Regulator of chromosome condensation

IPR000408 527 578 PS50012 Regulator of chromosome condensation

IPR000408 579 629 PS50012 Regulator of chromosome condensation

IPR000219 691 886 PS50010 DH

IPR003123 1514 1658 PS51205 Vacuolar sorting protein 9

ScanRegExp IPR000408 156 166 PS00626 Regulator of chromosome condensation

IPR000408 207 217 PS00626 Regulator of chromosome condensation

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000408	528	544	PR00633	Regulator of chromosome condensation
IPR000408	562	575	PR00633	Regulator of chromosome condensation
IPR000408	581	597	PR00633	Regulator of chromosome condensation
HMMPfam	IPR003409	1050	1072	PF02493	MORN motif
IPR003409	1073	1095	PF02493	MORN motif
IPR003409	1101	1123	PF02493	MORN motif
IPR003409	1124	1146	PF02493	MORN motif
IPR003409	1152	1174	PF02493	MORN motif
IPR003409	1176	1198	PF02493	MORN motif
IPR003409	1199	1221	PF02493	MORN motif
IPR003409	1222	1245	PF02493	MORN motif
IPR003123	1553	1657	PF02204	Vacuolar sorting protein 9
HMMSmart	IPR003409	1048	1069	SM00698	MORN motif
IPR003409	1071	1092	SM00698	MORN motif
IPR003409	1099	1120	SM00698	MORN motif
IPR003409	1122	1143	SM00698	MORN motif
IPR003409	1150	1171	SM00698	MORN motif
IPR003409	1174	1195	SM00698	MORN motif
IPR003409	1197	1218	SM00698	MORN motif
IPR003409	1220	1242	SM00698	MORN motif
ProfileScan	IPR000408	61	110	PS50012	Regulator of chromosome condensation
IPR000408	111	169	PS50012	Regulator of chromosome condensation
IPR000408	170	220	PS50012	Regulator of chromosome condensation
IPR000408	527	578	PS50012	Regulator of chromosome condensation
IPR000408	579	629	PS50012	Regulator of chromosome condensation
IPR000219	691	886	PS50010	DH
IPR003123	1514	1658	PS51205	Vacuolar sorting protein 9
ScanRegExp	IPR000408	156	166	PS00626	Regulator of chromosome condensation
IPR000408	207	217	PS00626	Regulator of chromosome condensation

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATGTTACTACCAGATTCAGCG

Primer_r
: GTAAGGCTCATTCTAACAACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1297 bp
Genome contig ID	gi89161199r_202173522
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AACAGCAATTTTCATAATAAAAGGCATTCATCTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGTGGTTGTTTTATGATTGTAGAAGAAATGAACAGGGCAGCCTAAAAGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	202273522	202341919	33	99.8	Terminal No-hit

Primer_f	: ATGTTACTACCAGATTCAGCG
Primer_r	: GTAAGGCTCATTCTAACAACC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1563

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information