HUGE

Gene/Protein Characteristic Table for KIAA1576

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00867
Accession No. :	AB046796
Description :
HUGO Gene Name :	vesicle amine transport protein 1 homolog (T. californica)-like (VAT1L)
Clone Name :	fj02237 [Vector Info]
Flexi ORF Clone :	pF1KSDA1576
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3760 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2411 bp

Genome contig ID gi51511732f_76279992
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
AAATATAAATAAAGTATTCAGCATAGCAAAACCTC
Flanking genome sequence
(291514 - 291563)
----+----*----+----*----+----*----+----*----+----*
ACCTGGCATCTGCTATTCCACATAATTCATTGCTGGATAAGCAGTCGCAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 76379992 76571504 9 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 448 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001105796	7.7e-150	98.4	similar to Syna...	Macaca mulatta
XP_852661	4.3e-145	96.2	similar to Syna...	Canis lupus fam...
BAF82842	2.3e-141	99.8	unnamed protein...	Homo sapiens
CAH93436	4.2e-140	98.8	hypothetical pr...	Pongo abelii
AAI14122	2e-138	97.4	Hypothetical pr...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013154 97 178 PF08240 Alcohol dehydrogenase GroES-like

IPR013149 209 365 PF00107 Alcohol dehydrogenase

ScanRegExp IPR002364 210 231 PS01162 Quinone oxidoreductase/zeta-crystallin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013154	97	178	PF08240	Alcohol dehydrogenase GroES-like
IPR013149	209	365	PF00107	Alcohol dehydrogenase
ScanRegExp	IPR002364	210	231	PS01162	Quinone oxidoreductase/zeta-crystallin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGTGGCATTCCTAGTAAGTTG

Primer_r
: TCGTCTGGACATAACAAAGGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2411 bp
Genome contig ID	gi51511732f_76279992
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- AAATATAAATAAAGTATTCAGCATAGCAAAACCTC
Flanking genome sequence (291514 - 291563)	----+--------+--------+--------+--------+----* ACCTGGCATCTGCTATTCCACATAATTCATTGCTGGATAAGCAGTCGCAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	76379992	76571504	9	99.3	Perfect prediction

Primer_f	: AGTGGCATTCCTAGTAAGTTG
Primer_r	: TCGTCTGGACATAACAAAGGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1576

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information