HUGE

Gene/Protein Characteristic Table for KIAA1578

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05475
Accession No. :	AB046798
Description :	E3 ubiquitin-protein ligase HUWE1.
HUGO Gene Name :
Clone Name :	fj04270 [Vector Info]
Source :	Human fetal brain
Note :	Please refer to "Gene/Protein Characteristic Table for KIAA0312" because the cDNA sequence of KIAA1578 is included in KIAA0312.

Features of the cloned DNA sequence	Description

Length: 3670 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1202 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAC06833	98.3	HECT domain pro...	Homo sapiens
CAI39581	98.3	HECT, UBA and W...	Homo sapiens
EAW93160	98.3	HECT, UBA and W...	Homo sapiens
EAW93162	98.3	HECT, UBA and W...	Homo sapiens
AAV90838	98.3	ARF-binding pro...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002310	0	98.2	KIAA0312

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000449 72 110 PF00627 Ubiquitin-associated/Translation elongation factor EF1B

IPR004170 364 435 PF02825 WWE

HMMSmart IPR000449 73 109 SM00165 Ubiquitin-associated/Translation elongation factor EF1B

ProfileScan IPR000449 71 110 PS50030 Ubiquitin-associated/Translation elongation factor EF1B

IPR004170 358 435 PS50918 WWE

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000449	72	110	PF00627	Ubiquitin-associated/Translation elongation factor EF1B
IPR004170	364	435	PF02825	WWE
HMMSmart	IPR000449	73	109	SM00165	Ubiquitin-associated/Translation elongation factor EF1B
ProfileScan	IPR000449	71	110	PS50030	Ubiquitin-associated/Translation elongation factor EF1B
IPR004170	358	435	PS50918	WWE

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AACATCATTCGGCTTTTCCTG

Primer_r
: TACTGGGCTGGTTCACAATCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: X

Experimental conditions

Panel name	: CCR
Primer_f	: CAGAGCAGTGACTTTGATACG
Primer_r	: GAGGTAGGCATTAAAGGTTTG
PCR product length	: 218(1.6k) bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Primer_f	: AACATCATTCGGCTTTTCCTG
Primer_r	: TACTGGGCTGGTTCACAATCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1578

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information