HUGE |
Gene/Protein Characteristic Table for KIAA0312 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05590 |
---|---|
Accession No. : | AB002310 |
Description : | E3 ubiquitin-protein ligase HUWE1. |
HUGO Gene Name : | HECT, UBA and WWE domain containing 1 (HUWE1) |
Clone Name : | ff01724 [Vector Info] |
Source : | Human fetal brain |
Note : | We replaced hg00137, former representative clones for KIAA0312 with ff01724. (2003/8/28) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 10790 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1211 bp Genome contig ID gi89161218r_53475828 PolyA signal sequence
(AATAAA,-30) +----*----+----*----+----*----+----
AATTTAATAAAAATTTAGTTAGAAAAAATAACCCCFlanking genome sequence
(99956 - 99907) ----+----*----+----*----+----*----+----*----+----*
AAGTGGTGCTTGCCTTGTGTGGTTTTTCTCATTTTCCTGGGGTGCTACCT
Features of the protein sequence |
Description | |
---|---|---|
Length: 3192 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: AGCCCAAAGCCTTCAGAGCAC | |
: ATCGAGATGACAGGTCCACAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: X |
: GeneBridge 4 | |
: AGCCCAAAGCCTTCAGAGCAC | |
: ATCGAGATGACAGGTCCACAG | |
: 141 (0.8k) bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |