| HUGE |
Gene/Protein Characteristic Table for KIAA0312 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK05590 |
|---|---|
| Accession No. : | AB002310 |
| Description : | E3 ubiquitin-protein ligase HUWE1. |
| HUGO Gene Name : | HECT, UBA and WWE domain containing 1 (HUWE1) |
| Clone Name : | ff01724 [Vector Info] |
| Source : | Human fetal brain |
| Note : | We replaced hg00137, former representative clones for KIAA0312 with ff01724. (2003/8/28) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 10790 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1211 bp Genome contig ID gi89161218r_53475828 PolyA signal sequence
(AATAAA,-30)
AATTTAATAAAAATTTAGTTAGAAAAAATAACCCCFlanking genome sequence
(99956 - 99907)
AAGTGGTGCTTGCCTTGTGTGGTTTTTCTCATTTTCCTGGGGTGCTACCT
Features of the protein sequence |
Description | |
|---|---|---|
Length: 3192 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : AGCCCAAAGCCTTCAGAGCAC | |
| : ATCGAGATGACAGGTCCACAG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : X |
| : GeneBridge 4 | |
| : AGCCCAAAGCCTTCAGAGCAC | |
| : ATCGAGATGACAGGTCCACAG | |
| : 141 (0.8k) bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
