| HUGE |
Gene/Protein Characteristic Table for KIAA0439 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00077 |
|---|---|
| Accession No. : | AB007899 |
| Description : | E3 ubiquitin-protein ligase NEDD4-like protein. |
| HUGO Gene Name : | neural precursor cell expressed, developmentally down-regulated 4-like (NEDD4L) |
| Clone Name : | hj00462 [Vector Info] |
| Flexi ORF Clone : | pF1KA0439
|
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4879 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Features of the protein sequence |
Description | |
|---|---|---|
Length: 995 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| FPrintScan | IPR000008 | 77 | 89 | PR00360 | C2 calcium-dependent membrane targeting |
| IPR000008 | 108 | 121 | PR00360 | C2 calcium-dependent membrane targeting | |
| HMMPfam | IPR000008 | 79 | 149 | PF00168 | C2 calcium-dependent membrane targeting |
| IPR001202 | 235 | 264 | PF00397 | WW/Rsp5/WWP | |
| IPR001202 | 407 | 436 | PF00397 | WW/Rsp5/WWP | |
| IPR001202 | 519 | 548 | PF00397 | WW/Rsp5/WWP | |
| IPR001202 | 570 | 599 | PF00397 | WW/Rsp5/WWP | |
| IPR000569 | 689 | 994 | PF00632 | HECT | |
| HMMSmart | IPR000008 | 53 | 164 | SM00239 | C2 calcium-dependent membrane targeting |
| IPR001202 | 234 | 266 | SM00456 | WW/Rsp5/WWP | |
| IPR001202 | 406 | 438 | SM00456 | WW/Rsp5/WWP | |
| IPR001202 | 518 | 550 | SM00456 | WW/Rsp5/WWP | |
| IPR001202 | 569 | 601 | SM00456 | WW/Rsp5/WWP | |
| IPR000569 | 658 | 994 | SM00119 | HECT | |
| ProfileScan | IPR000008 | 69 | 149 | PS50004 | C2 calcium-dependent membrane targeting |
| IPR001202 | 233 | 266 | PS50020 | WW/Rsp5/WWP | |
| IPR001202 | 405 | 438 | PS50020 | WW/Rsp5/WWP | |
| IPR001202 | 517 | 550 | PS50020 | WW/Rsp5/WWP | |
| IPR001202 | 568 | 601 | PS50020 | WW/Rsp5/WWP | |
| IPR000569 | 660 | 994 | PS50237 | HECT | |
| ScanRegExp | IPR001202 | 239 | 264 | PS01159 | WW/Rsp5/WWP |
| IPR001202 | 411 | 436 | PS01159 | WW/Rsp5/WWP | |
| IPR001202 | 523 | 548 | PS01159 | WW/Rsp5/WWP | |
| IPR001202 | 574 | 599 | PS01159 | WW/Rsp5/WWP |
| Method | No. | N terminal | transmembrane region | C terminal | type | length |
|---|---|---|---|---|---|---|
| - | - | - | - | - | - | - |
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : GGTCGTTCAACTCCCACACTG | |
| : ACTTGACTTGATCCTCTGAGC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 18 |
| : GeneBridge 4 | |
| : GGTCGTTCAACTCCCACACTG | |
| : ACTTGACTTGATCCTCTGAGC | |
| : 159 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
