HUGE |
Gene/Protein Characteristic Table for KIAA1301 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00211 |
---|---|
Accession No. : | AB037722 |
Description : | E3 ubiquitin-protein ligase HECW2. |
HUGO Gene Name : | HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 (HECW2) |
Clone Name : | fg06833 [Vector Info] |
Flexi ORF Clone : | pF1KA1301
![]() |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6926 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2024 bp Genome contig ID gi89161199r_196672222 PolyA signal sequence
(AATACA,-25) +----*----+----*----+----*----+----
ATTGATCATGAATACAAGTATATATTTAATTTTGCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAACTTTTCACTTGTTTGTATTCTTTTCATTATAAGGAAAAGTAGTATAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 r 196772222 197165580 29 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1581 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GACATGGTTCCAGTGGCTTAC | |
: AACATAACAAGGTCTGCATCG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 2 |
: GeneBridge 4 | |
: AGACACAGGGACTTCCGATGC | |
: TGGTCACACTCTCATTGCAGG | |
: 212 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |