HUGE |
Gene/Protein Characteristic Table for KIAA0322 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01066 |
---|---|
Accession No. : | AB002320 |
Description : | E3 ubiquitin-protein ligase HECW1. |
HUGO Gene Name : | HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 (HECW1) |
Clone Name : | hg00462s1 [Vector Info] |
Flexi ORF Clone : | pF1KA0322
![]() |
Source : | Human adult brain |
Note : | We replaced hg00462, former representative clones for KIAA0322 with hg00462s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6838 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1412 bp Genome contig ID gi89161213f_43018723 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
TCAACTACATTTGAAATAAACCCAACCATAATGGTFlanking genome sequence
(550742 - 550791) ----+----*----+----*----+----*----+----*----+----*
CATTTGCTATTTTTCTAACGTTGTTATCCATGTTGCCTGAAATAGGTCAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 7 f 43118723 43569463 30 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1614 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: AATGTAGTTGAGAGGTTAGGC | |
: AACATAACACCCCAAAGGCAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 7 |
: GeneBridge 4 | |
: AATGTAGTTGAGAGGTTAGGC | |
: AACATAACACCCCAAAGGCAC | |
: 147 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |