HUGE

Gene/Protein Characteristic Table for KIAA0322

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01066
Accession No. :	AB002320
Description :	E3 ubiquitin-protein ligase HECW1.
HUGO Gene Name :	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 (HECW1)
Clone Name :	hg00462s1 [Vector Info]
Flexi ORF Clone :	pF1KA0322
Source :	Human adult brain
Note :	We replaced hg00462, former representative clones for KIAA0322 with hg00462s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6838 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1412 bp

Genome contig ID gi89161213f_43018723
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TCAACTACATTTGAAATAAACCCAACCATAATGGT
Flanking genome sequence
(550742 - 550791)
----+----*----+----*----+----*----+----*----+----*
CATTTGCTATTTTTCTAACGTTGTTATCCATGTTGCCTGAAATAGGTCAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 f 43118723 43569463 30 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1614 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW94160	99.9	HECT, C2 and WW...	Homo sapiens
Q76N89	100.0	E3 ubiquitin-pr...	Homo sapiens
NP_055867	99.9	NEDD4-like ubiq...	Homo sapiens
EAW94158	99.8	HECT, C2 and WW...	Homo sapiens
XP_001096775	99.1	similar to HECT...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037722	1.1e-131	57.1	KIAA1301
AB007899	1.5e-43	35.0	KIAA0439
D42055	4.2e-43	36.4	KIAA0093
AB046845	1.8e-38	46.9	KIAA1625
AB002310	3.6e-31	42.0	KIAA0312

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000008 215 310 PF00168 C2 calcium-dependent membrane targeting

IPR001202 839 868 PF00397 WW/Rsp5/WWP

IPR001202 1028 1057 PF00397 WW/Rsp5/WWP

IPR000569 1309 1614 PF00632 HECT

HMMSmart IPR000008 214 325 SM00239 C2 calcium-dependent membrane targeting

IPR001202 838 870 SM00456 WW/Rsp5/WWP

IPR001202 1027 1059 SM00456 WW/Rsp5/WWP

IPR000569 1277 1614 SM00119 HECT

ProfileScan IPR000008 214 310 PS50004 C2 calcium-dependent membrane targeting

IPR001202 837 870 PS50020 WW/Rsp5/WWP

IPR001202 1026 1059 PS50020 WW/Rsp5/WWP

IPR000569 1279 1614 PS50237 HECT

ScanRegExp IPR001202 843 868 PS01159 WW/Rsp5/WWP

IPR001202 1032 1057 PS01159 WW/Rsp5/WWP

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000008	215	310	PF00168	C2 calcium-dependent membrane targeting
IPR001202	839	868	PF00397	WW/Rsp5/WWP
IPR001202	1028	1057	PF00397	WW/Rsp5/WWP
IPR000569	1309	1614	PF00632	HECT
HMMSmart	IPR000008	214	325	SM00239	C2 calcium-dependent membrane targeting
IPR001202	838	870	SM00456	WW/Rsp5/WWP
IPR001202	1027	1059	SM00456	WW/Rsp5/WWP
IPR000569	1277	1614	SM00119	HECT
ProfileScan	IPR000008	214	310	PS50004	C2 calcium-dependent membrane targeting
IPR001202	837	870	PS50020	WW/Rsp5/WWP
IPR001202	1026	1059	PS50020	WW/Rsp5/WWP
IPR000569	1279	1614	PS50237	HECT
ScanRegExp	IPR001202	843	868	PS01159	WW/Rsp5/WWP
IPR001202	1032	1057	PS01159	WW/Rsp5/WWP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: AATGTAGTTGAGAGGTTAGGC

Primer_r
: AACATAACACCCCAAAGGCAC

PCR conditions
: 95 °C30 sec61 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AATGTAGTTGAGAGGTTAGGC
Primer_r	: AACATAACACCCCAAAGGCAC
PCR product length	: 147 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1412 bp
Genome contig ID	gi89161213f_43018723
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TCAACTACATTTGAAATAAACCCAACCATAATGGT
Flanking genome sequence (550742 - 550791)	----+--------+--------+--------+--------+----* CATTTGCTATTTTTCTAACGTTGTTATCCATGTTGCCTGAAATAGGTCAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	f	43118723	43569463	30	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0322

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information