HUGE |
Gene/Protein Characteristic Table for KIAA1596 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04983 |
---|---|
Accession No. : | AB046816 |
Description : | Fanconi anemia group M protein. |
HUGO Gene Name : | |
Clone Name : | fj09605 [Vector Info] |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4696 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 876 bp Genome contig ID gi51511730f_44614086 PolyA signal sequence
(ATTAAA,-20) +----*----+----*----+----*----+----
CAGGACTGTGAGTCAATTAAACATCTTTTCCTTATFlanking genome sequence
(125753 - 125802) ----+----*----+----*----+----*----+----*----+----*
AAATTACCCAGTCGGGTTATTTCTTCATAGCAGCGTGAGAATGGACTAAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 14 f 44714086 44739837 11 99.8 Internal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 1151 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: ATGAAGTCCAGTCTACCACAC | |
: AAGAGAAGTATGTGTCCCAGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 14 |
: CCR | |
: AATCGCATGGTGGTGGAAAGG | |
: CTGTCATAGCTCTTTGTTCTC | |
: 185 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |