HUGE

Gene/Protein Characteristic Table for KIAA1597

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00253
Accession No. :	AB046817
Description :	Synaptotagmin-like protein 2.
HUGO Gene Name :	synaptotagmin-like 2 (SYTL2)
Clone Name :	fj09819 [Vector Info]
Flexi ORF Clone :	pF1KA1597
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4251 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 912 bp

Genome contig ID gi51511727r_84982975
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
ACCCTTAGAATAAATTATCATTTGATTTAAATTGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTAGAAAATTAGCGTGACTTCTCATTTTAAATAAAATATTTTAGGAATT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 r 85082975 85199826 20 99.6 Internal No-hit

Features of the protein sequence	Description

Length: 913 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW75111	99.9	synaptotagmin-l...	Homo sapiens
BAG10475	100.0	synaptotagmin-l...	synthetic construct
Q9HCH5	99.9	Synaptotagmin-l...	Homo sapiens
EAW75107	99.7	synaptotagmin-l...	Homo sapiens
XP_001175275	98.9	synaptotagmin-l...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023202	3.4e-05	22.3	KIAA0985

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000008 640 652 PR00360 C2 calcium-dependent membrane targeting

IPR000008 669 682 PR00360 C2 calcium-dependent membrane targeting

HMMPfam IPR000008 624 713 PF00168 C2 calcium-dependent membrane targeting

IPR000008 773 860 PF00168 C2 calcium-dependent membrane targeting

HMMSmart IPR000008 623 728 SM00239 C2 calcium-dependent membrane targeting

IPR000008 772 875 SM00239 C2 calcium-dependent membrane targeting

ProfileScan IPR010911 4 60 PS50916 Rab-binding

IPR000008 623 713 PS50004 C2 calcium-dependent membrane targeting

IPR000008 772 860 PS50004 C2 calcium-dependent membrane targeting

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000008	640	652	PR00360	C2 calcium-dependent membrane targeting
IPR000008	669	682	PR00360	C2 calcium-dependent membrane targeting
HMMPfam	IPR000008	624	713	PF00168	C2 calcium-dependent membrane targeting
IPR000008	773	860	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	623	728	SM00239	C2 calcium-dependent membrane targeting
IPR000008	772	875	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR010911	4	60	PS50916	Rab-binding
IPR000008	623	713	PS50004	C2 calcium-dependent membrane targeting
IPR000008	772	860	PS50004	C2 calcium-dependent membrane targeting

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACTGAAGTGGACTGGATGGAC

Primer_r
: TTCAAGATCAGATTCCACCGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: CCR
Primer_f	: ACTGAAGTGGACTGGATGGAC
Primer_r	: TTCAAGATCAGATTCCACCGG
PCR product length	: 192 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	912 bp
Genome contig ID	gi51511727r_84982975
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- ACCCTTAGAATAAATTATCATTTGATTTAAATTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTAGAAAATTAGCGTGACTTCTCATTTTAAATAAAATATTTTAGGAATT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	r	85082975	85199826	20	99.6	Internal No-hit

Gene/Protein Characteristic Table for KIAA1597

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information