HUGE

Gene/Protein Characteristic Table for KIAA1600

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05678
Accession No. :	AB046820
Description :
HUGO Gene Name :
Clone Name :	fj10035s1 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fj10035, former representative clones for KIAA1600 with fj10035s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5401 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3173 bp

Genome contig ID gi89161187f_116480626
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
GGGATGATCTAAAAAATAAATAATGTAATTTAAAC
Flanking genome sequence
(133838 - 133887)
----+----*----+----*----+----*----+----*----+----*
AAAACGTCTTATGTTTTTGTAAAATTCTAATTGGGAACATTTTATCCAAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 f 116580626 116614462 16 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 741 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q5W0V3	100.0	UPF0518 protein...	Homo sapiens
CAI45992	99.6	hypothetical pr...	Homo sapiens
XP_508052	96.9	hypothetical pr...	Pan troglodytes
CAH70000	99.9	novel protein [...	Homo sapiens
AAH37207	99.7	FAM160B1 protei...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGACCAAAATTCTTAGCTCGC

Primer_r
: TTCACTGTAACGTCTTCTGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3173 bp
Genome contig ID	gi89161187f_116480626
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GGGATGATCTAAAAAATAAATAATGTAATTTAAAC
Flanking genome sequence (133838 - 133887)	----+--------+--------+--------+--------+----* AAAACGTCTTATGTTTTTGTAAAATTCTAATTGGGAACATTTTATCCAAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	f	116580626	116614462	16	99.4	Perfect prediction

Primer_f	: GGACCAAAATTCTTAGCTCGC
Primer_r	: TTCACTGTAACGTCTTCTGTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1600

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information