HUGE

Gene/Protein Characteristic Table for KIAA1617

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00880
Accession No. :	AB046837
Description :	Scm-like with four MBT domains protein 2.
HUGO Gene Name :	Scm-like with four mbt domains 2 (SFMBT2)
Clone Name :	fj13890 [Vector Info]
Flexi ORF Clone :	pF1KSDA1617
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4259 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1483 bp

Genome contig ID gi89161187r_7144255
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CCCACTCATGCTGGAAAGGAAGATCCAGATCGTAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAATTAGAAAAAGAAAGAATAAGAAGGGTCTGGTCCCAGTTCTGACTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 r 7244255 7491309 21 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 904 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q5VUG0	100.0	Scm-like with f...	Homo sapiens
XP_001118715	97.9	Scm-like with f...	Macaca mulatta
XP_850333	92.1	similar to Scm-...	Canis lupus fam...
XP_001500014	91.8	similar to Scm-...	Equus caballus
XP_607062	90.9	similar to Scm-...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014581	1e-14	31.5	KIAA0681
AB058701	4.8e-11	29.7	KIAA1798

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004092 88 163 PF02820 Mbt repeat

IPR004092 203 270 PF02820 Mbt repeat

IPR004092 314 391 PF02820 Mbt repeat

IPR004092 422 492 PF02820 Mbt repeat

IPR011510 831 897 PF07647 Sterile alpha motif homology 2

HMMSmart IPR004092 54 154 SM00561 Mbt repeat

IPR004092 162 266 SM00561 Mbt repeat

IPR004092 276 382 SM00561 Mbt repeat

IPR004092 390 487 SM00561 Mbt repeat

IPR001660 831 897 SM00454 Sterile alpha motif SAM

ProfileScan IPR004092 54 154 PS51079 Mbt repeat

IPR004092 162 266 PS51079 Mbt repeat

IPR004092 276 382 PS51079 Mbt repeat

IPR004092 390 487 PS51079 Mbt repeat

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004092	88	163	PF02820	Mbt repeat
IPR004092	203	270	PF02820	Mbt repeat
IPR004092	314	391	PF02820	Mbt repeat
IPR004092	422	492	PF02820	Mbt repeat
IPR011510	831	897	PF07647	Sterile alpha motif homology 2
HMMSmart	IPR004092	54	154	SM00561	Mbt repeat
IPR004092	162	266	SM00561	Mbt repeat
IPR004092	276	382	SM00561	Mbt repeat
IPR004092	390	487	SM00561	Mbt repeat
IPR001660	831	897	SM00454	Sterile alpha motif SAM
ProfileScan	IPR004092	54	154	PS51079	Mbt repeat
IPR004092	162	266	PS51079	Mbt repeat
IPR004092	276	382	PS51079	Mbt repeat
IPR004092	390	487	PS51079	Mbt repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGATCGAGAGAGTCAAAGTGG

Primer_r
: ACATGGAAACAGCTCACAGGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: CCR
Primer_f	: AGATCGAGAGAGTCAAAGTGG
Primer_r	: ACATGGAAACAGCTCACAGGC
PCR product length	: 219 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1483 bp
Genome contig ID	gi89161187r_7144255
PolyA signal sequence (None)	+--------+--------+----*----+---- CCCACTCATGCTGGAAAGGAAGATCCAGATCGTAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAATTAGAAAAAGAAAGAATAAGAAGGGTCTGGTCCCAGTTCTGACTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	r	7244255	7491309	21	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA1617

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information