HUGE

Gene/Protein Characteristic Table for KIAA1798

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00921
Accession No. :	AB058701
Description :	Lethal(3)malignant brain tumor-like 3 protein.
HUGO Gene Name :	l(3)mbt-like 3 (Drosophila) (L3MBTL3)
Clone Name :	fj20547 [Vector Info]
Flexi ORF Clone :	pF1KSDA1798
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4101 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1684 bp

Genome contig ID gi89161210f_130285085
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
TATATCTGACATGAATGAAATAAAATCTTAATTAC
Flanking genome sequence
(219192 - 219241)
----+----*----+----*----+----*----+----*----+----*
AGATGCTTTTTACATATGTATGATTTTTAAGAAAGCTTCTCAAATAGGAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 f 130385085 130504275 22 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 781 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10151	100.0	lethal(3)malign...	synthetic construct
Q96JM7	99.9	Lethal(3)malign...	Homo sapiens
XP_518737	99.9	l(3)mbt-like 3 ...	Pan troglodytes
XP_001504317	96.8	l(3)mbt-like 3 ...	Equus caballus
XP_001104756	96.9	similar to l(3)...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014581	1.6e-81	54.2	KIAA0681
AB046837	1.1e-10	29.7	KIAA1617

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004092 269 342 PF02820 Mbt repeat

IPR004092 376 449 PF02820 Mbt repeat

IPR004092 480 546 PF02820 Mbt repeat

IPR001660 707 771 PF00536 Sterile alpha motif SAM

HMMSmart IPR004092 233 333 SM00561 Mbt repeat

IPR004092 341 440 SM00561 Mbt repeat

IPR004092 449 544 SM00561 Mbt repeat

IPR001660 706 773 SM00454 Sterile alpha motif SAM

ProfileScan IPR004092 233 333 PS51079 Mbt repeat

IPR004092 341 440 PS51079 Mbt repeat

IPR004092 449 544 PS51079 Mbt repeat

IPR001660 709 773 PS50105 Sterile alpha motif SAM

ScanRegExp IPR000886 778 781 PS00014 Endoplasmic reticulum targeting sequence

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004092	269	342	PF02820	Mbt repeat
IPR004092	376	449	PF02820	Mbt repeat
IPR004092	480	546	PF02820	Mbt repeat
IPR001660	707	771	PF00536	Sterile alpha motif SAM
HMMSmart	IPR004092	233	333	SM00561	Mbt repeat
IPR004092	341	440	SM00561	Mbt repeat
IPR004092	449	544	SM00561	Mbt repeat
IPR001660	706	773	SM00454	Sterile alpha motif SAM
ProfileScan	IPR004092	233	333	PS51079	Mbt repeat
IPR004092	341	440	PS51079	Mbt repeat
IPR004092	449	544	PS51079	Mbt repeat
IPR001660	709	773	PS50105	Sterile alpha motif SAM
ScanRegExp	IPR000886	778	781	PS00014	Endoplasmic reticulum targeting sequence

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTGTCTGAATTCTGGGGTAAG

Primer_r
: GCAAATAAATGACTGGGACAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1684 bp
Genome contig ID	gi89161210f_130285085
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TATATCTGACATGAATGAAATAAAATCTTAATTAC
Flanking genome sequence (219192 - 219241)	----+--------+--------+--------+--------+----* AGATGCTTTTTACATATGTATGATTTTTAAGAAAGCTTCTCAAATAGGAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	f	130385085	130504275	22	99.9	Perfect prediction

Primer_f	: CTGTCTGAATTCTGGGGTAAG
Primer_r	: GCAAATAAATGACTGGGACAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1798

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information