HUGE |
Gene/Protein Characteristic Table for KIAA1627 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00881 |
---|---|
Accession No. : | AB046847 |
Description : | |
HUGO Gene Name : | |
Clone Name : | hh13711s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1627 |
Source : | Human adult brain |
Note : | We replaced hh13711, former representative clones for KIAA1627 with hh13711s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2109 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 618 bp Genome contig ID gi89161207f_119726018 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GGTGAAAGAAGAGATAGAACTTAGCAGGCAGACTTFlanking genome sequence
(125507 - 125556) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAGTTTATCATCATAATCTCAATTTTGTGGCTATGAC
Chr f/r start end exon identity class ContigView(URL based/DAS) 4 f 119826018 119851523 11 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 468 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GTGAACAGAATGGAACAACTC | |
: CTCTATTCTATCAAGGCCCTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 4 |
: RH-map | |
: GTGAACAGAATGGAACAACTC | |
: CTCTATTCTATCAAGGCCCTG | |
: 167 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |