HUGE |
Gene/Protein Characteristic Table for KIAA1635 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | |
---|---|
Accession No. : | AB046855 |
Description : | mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like. |
HUGO Gene Name : | mediator complex subunit 12-like (MED12L) |
Clone Name : | fh23184 [Vector Info] |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5808 bp
![]() |
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
cloned DNA seq. | ||
Warning for N-terminal truncation: | YES | YES |
Warning for coding interruption: | YES | NO |
Length of 3'UTR 1232 bp Genome contig ID gi89161205f_152450536 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CAGTTTGTGTAACTTAAGAGATCGCGAGCGGCCGCFlanking genome sequence None
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 f 152550533 152634501 29 99.7 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 1435 aa
This protein sequence is predicted from the revised DNA sequence
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AACAGCATTGAAGTGGGAGCC | |
: TTTGGATTTTGTGAGGCAGTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 3 |
: CCR | |
: GGCAATCCTGGTTAGAACTCC | |
: TACTGTTTGGGTTGAAGAGGC | |
: 186(300) bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |