HUGE |
Gene/Protein Characteristic Table for KIAA0192 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01589 |
---|---|
Accession No. : | D83783 |
Description : | Mediator of RNA polymerase II transcription subunit 12. |
HUGO Gene Name : | mediator complex subunit 12 (MED12) |
Clone Name : | ha02370 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0192
![]() |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6604 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 229 bp Genome contig ID gi89161218f_70156008 PolyA signal sequence
(AATACA,-20) +----*----+----*----+----*----+----
AGAGCTGTTGCACCCAATACACAGAGCTTCTTTGCFlanking genome sequence
(123016 - 123065) ----+----*----+----*----+----*----+----*----+----*
AAAGGGAGTGTGCGAGTTCTGCATGTCTGGGAAGGGTGGTCTCTTGGGAG
Features of the protein sequence |
Description | |
---|---|---|
Length: 2124 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: X |
: Genebridge 4 | |
: CGTTGTAATACCCTTCCTGAC | |
: TTTTGGCTAGTTGCGTGAGTG | |
: 151 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |