HUGE |
Gene/Protein Characteristic Table for KIAA1637 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK06118 |
---|---|
Accession No. : | AB046857 |
Description : | Nuclear receptor coactivator 5. |
HUGO Gene Name : | |
Clone Name : | fj00747s1 [Vector Info] |
Source : | Human fetal brain |
Note : | We replaced fj00747, former representative clones for KIAA1637 with fj00747s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2753 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1311 bp Genome contig ID gi51511747r_44023035 PolyA signal sequence
(ATTAAA,-17) +----*----+----*----+----*----+----
TGAAATGATTACTTTTTAATTAAAATGAAAAAAGTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAAGCTTTGTTCATCTTTTTTGGGTGTGAATATGCTCTTTGCAGGATGC
Chr f/r start end exon identity class ContigView(URL based/DAS) 20 r 44123035 44132322 6 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 479 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR004154 | 99 | 193 | PF03129 | Anticodon-binding |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CAGGCTCTTGTTTTTGTCTAG | |
: GAACCACAGCCAGAAACCCTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 20 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |