HUGE

Gene/Protein Characteristic Table for KIAA1637

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06118
Accession No. :	AB046857
Description :	Nuclear receptor coactivator 5.
HUGO Gene Name :
Clone Name :	fj00747s1 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fj00747, former representative clones for KIAA1637 with fj00747s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 2753 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1311 bp

Genome contig ID gi51511747r_44023035
PolyA signal sequence
(ATTAAA,-17)
+----*----+----*----+----*----+----
TGAAATGATTACTTTTTAATTAAAATGAAAAAAGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAGCTTTGTTCATCTTTTTTGGGTGTGAATATGCTCTTTGCAGGATGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 r 44123035 44132322 6 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 479 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9HCD5	3e-145	100.0	Nuclear recepto...	Homo sapiens
AAG36793	3.1e-145	100.0	nuclear recepto...	Homo sapiens
EAW75764	3.2e-145	100.0	nuclear recepto...	Homo sapiens
XP_514691	5.2e-145	99.8	nuclear recepto...	Pan troglodytes
XP_001108239	1.2e-144	99.6	similar to nucl...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004154 99 193 PF03129 Anticodon-binding

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004154	99	193	PF03129	Anticodon-binding

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAGGCTCTTGTTTTTGTCTAG

Primer_r
: GAACCACAGCCAGAAACCCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1311 bp
Genome contig ID	gi51511747r_44023035
PolyA signal sequence (ATTAAA,-17)	+--------+--------+----*----+---- TGAAATGATTACTTTTTAATTAAAATGAAAAAAGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAGCTTTGTTCATCTTTTTTGGGTGTGAATATGCTCTTTGCAGGATGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	r	44123035	44132322	6	100.0	Perfect prediction

Primer_f	: CAGGCTCTTGTTTTTGTCTAG
Primer_r	: GAACCACAGCCAGAAACCCTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1637

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information