HUGE

Gene/Protein Characteristic Table for KIAA1650

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06823
Accession No. :	AB051437
Description :	SH3 and multiple ankyrin repeat domains protein 3.
HUGO Gene Name :	SH3 and multiple ankyrin repeat domains 3 (SHANK3)
Clone Name :	hk02174 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4293 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1898 bp

Genome contig ID gi89161203f_49405929
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TATAATATTATTATGTAATAAATTTATAAGAAATG
Flanking genome sequence
(112577 - 112626)
----+----*----+----*----+----*----+----*----+----*
AAGCCATGGCTCAGTTGCCTGCTTGAGGGGATATTTGTGTCTGTCCCTCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 22 f 49505929 49518504 2 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 797 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_001073889	100.0	SH3 and multipl...	Homo sapiens
BAG55459	98.9	SH3 and multipl...	Callithrix jacchus
BAB84864	100.0	FLJ00090 protei...	Homo sapiens
XP_589942	94.7	similar to prol...	Bos taurus
BAE16756	94.7	Shank3 [Mus mus...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028945	2.1e-11	35.7	KIAA1022

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001660 732 795 PF00536 Sterile alpha motif SAM

HMMSmart IPR001660 731 797 SM00454 Sterile alpha motif SAM

ProfileScan IPR001660 734 797 PS50105 Sterile alpha motif SAM

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001660	732	795	PF00536	Sterile alpha motif SAM
HMMSmart	IPR001660	731	797	SM00454	Sterile alpha motif SAM
ProfileScan	IPR001660	734	797	PS50105	Sterile alpha motif SAM

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 22

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1898 bp
Genome contig ID	gi89161203f_49405929
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TATAATATTATTATGTAATAAATTTATAAGAAATG
Flanking genome sequence (112577 - 112626)	----+--------+--------+--------+--------+----* AAGCCATGGCTCAGTTGCCTGCTTGAGGGGATATTTGTGTCTGTCCCTCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	22	f	49505929	49518504	2	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA1650

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information