| HUGE |
Gene/Protein Characteristic Table for KIAA1676 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK04691 |
|---|---|
| Accession No. : | AB051463 |
| Description : | CXXC-type zinc finger protein 6. |
| HUGO Gene Name : | tet oncogene 1 (TET1) |
| Clone Name : | fh07095 [Vector Info] |
| Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4834 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2626 bp Genome contig ID gi89161187f_69976696 PolyA signal sequence
(AATAAA,-31) +----*----+----*----+----*----+----
AGGAAATAAATTTGTTTGAAATGACATTTTCTCTCFlanking genome sequence
(147550 - 147599) ----+----*----+----*----+----*----+----*----+----*
ATAAAACTGGTCATCTAACATTATTTCTACCCCTCTATTATGTTTTACTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 10 f 70076696 70124244 10 99.4 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 735 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : TGACGCTTGTTGCAGTTTACC | |
| : AAATCACAGGGCAGAGAATGG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 10 |
| : GeneBridge 4 | |
| : TTAATACGGAAATCGCTGTGG | |
| : TAACCTCCAAATCGGCTTCTC | |
| : 169 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |