HUGE

Gene/Protein Characteristic Table for KIAA1684

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06253
Accession No. :	AB051471
Description :	p130Cas-associated protein.
HUGO Gene Name :
Clone Name :	fh24594 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3996 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1707 bp

Genome contig ID gi51511734r_33841370
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AAATAACAAAAGAGGAAAAAAAAAATCCCTCCTGG
Flanking genome sequence
(99980 - 99931)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAACCCTGGAAAATAGAAAAAAAAAAAAGGACCTCATAAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 33941350 33971661 13 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 762 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD03968	9.7e-214	100.0	SNAP-25-interac...	Homo sapiens
AAI56057	9.7e-214	100.0	SNAP25-interact...	synthetic construct
Q9C0H9	1.7e-213	99.9	p130Cas-associa...	Homo sapiens
XP_001082621	2.9e-212	99.3	SNAP25-interact...	Macaca mulatta
XP_001082755	3.2e-212	99.3	SNAP25-interact...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033043	2e-19	35.4	KIAA1217

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCCCGACAAAAGCAAACATGG

Primer_r
: CCCAAAGGAAGTCAATACAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1707 bp
Genome contig ID	gi51511734r_33841370
PolyA signal sequence (None)	+--------+--------+----*----+---- AAATAACAAAAGAGGAAAAAAAAAATCCCTCCTGG
Flanking genome sequence (99980 - 99931)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAACCCTGGAAAATAGAAAAAAAAAAAAGGACCTCATAAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	33941350	33971661	13	99.5	Perfect prediction

Primer_f	: CCCCGACAAAAGCAAACATGG
Primer_r	: CCCAAAGGAAGTCAATACAGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1684

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information