HUGE

Gene/Protein Characteristic Table for KIAA1688

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00887
Accession No. :	AB051475
Description :
HUGO Gene Name :
Clone Name :	fh26207 [Vector Info]
Flexi ORF Clone :	pF1KSDA1688
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5054 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1243 bp

Genome contig ID gi51511724r_145625371
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
GACGACACGAGTGAATAAAGTGCACATGGACCCTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CGCGTCCTCCCGTTCCTTGTGGGCGCGGCCGGGGGCGGGAAGAGACGCGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 r 145725371 145809699 12 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1094 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG59035	99.9	unnamed protein...	Homo sapiens
AAH60637	88.8	DNA segment, Ch...	Mus musculus
NP_775145	86.5	preoptic regula...	Rattus norvegicus
EDM15938	86.5	rCG59984 [Rattu...	Rattus norvegicus
EDL29616	86.5	DNA segment, Ch...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D29642	0.00053	31.3	KIAA0053

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001202 37 67 PF00397 WW/Rsp5/WWP

IPR001202 76 106 PF00397 WW/Rsp5/WWP

IPR000857 772 890 PF00784 Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4

IPR000198 920 1066 PF00620 RhoGAP

HMMSmart IPR001202 36 69 SM00456 WW/Rsp5/WWP

IPR001202 75 108 SM00456 WW/Rsp5/WWP

IPR000857 733 875 SM00139 Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4

IPR000198 917 1090 SM00324 RhoGAP

ProfileScan IPR001202 74 108 PS50020 WW/Rsp5/WWP

IPR000857 733 890 PS51016 Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4

IPR000198 901 1089 PS50238 RhoGAP

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001202	37	67	PF00397	WW/Rsp5/WWP
IPR001202	76	106	PF00397	WW/Rsp5/WWP
IPR000857	772	890	PF00784	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
IPR000198	920	1066	PF00620	RhoGAP
HMMSmart	IPR001202	36	69	SM00456	WW/Rsp5/WWP
IPR001202	75	108	SM00456	WW/Rsp5/WWP
IPR000857	733	875	SM00139	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
IPR000198	917	1090	SM00324	RhoGAP
ProfileScan	IPR001202	74	108	PS50020	WW/Rsp5/WWP
IPR000857	733	890	PS51016	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
IPR000198	901	1089	PS50238	RhoGAP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGAATCTATCCTGCATCGCAG

Primer_r
: GGTAGAGCTTGGTTTTTGGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: "8,15"

Experimental conditions

Panel name	: CCR
Primer_f	: AGAATCTATCCTGCATCGCAG
Primer_r	: GGTAGAGCTTGGTTTTTGGTC
PCR product length	: 209 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1243 bp
Genome contig ID	gi51511724r_145625371
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GACGACACGAGTGAATAAAGTGCACATGGACCCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CGCGTCCTCCCGTTCCTTGTGGGCGCGGCCGGGGGCGGGAAGAGACGCGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	r	145725371	145809699	12	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1688

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information