HUGE

Gene/Protein Characteristic Table for KIAA0053

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00387
Accession No. :	D29642
Description :	Rho GTPase-activating protein 25.
HUGO Gene Name :	Rho GTPase activating protein 25 (ARHGAP25)
Clone Name :	ha01417 [Vector Info]
Flexi ORF Clone :	pF1KSDA0053
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 2739 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 629 bp

Genome contig ID gi89161199f_68755624
PolyA signal sequence
(AATAAA,-15)
+----*----+----*----+----*----+----
TGATGAGAAAATTATATTCAAATAAAGCAAAATTT
Flanking genome sequence
(151837 - 151886)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAGGCTATTGCTAATCCATACGGCACCTTTGTGAGAATTAGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 68855624 68907459 10 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 666 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P42331	100.0	Rho GTPase-acti...	Homo sapiens
EAW99866	99.8	Rho GTPase acti...	Homo sapiens
XP_001135891	99.5	Rho GTPase acti...	Pan troglodytes
XP_001135811	99.4	Rho GTPase acti...	Pan troglodytes
NP_001007232	100.0	Rho GTPase acti...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007925	2.9e-07	23.8	KIAA0456
AB007871	7.7e-07	28.4	KIAA0411
AB018255	8.1e-07	26.6	KIAA0712
AB040934	1.7e-06	24.9	KIAA1501
AB037725	1.7e-06	29.3	KIAA1304

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001849 68 172 PF00169 Pleckstrin-like

IPR000198 198 351 PF00620 RhoGAP

HMMSmart IPR001849 68 174 SM00233 Pleckstrin-like

IPR000198 195 371 SM00324 RhoGAP

ProfileScan IPR001849 67 172 PS50003 Pleckstrin-like

IPR000198 180 374 PS50238 RhoGAP

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	68	172	PF00169	Pleckstrin-like
IPR000198	198	351	PF00620	RhoGAP
HMMSmart	IPR001849	68	174	SM00233	Pleckstrin-like
IPR000198	195	371	SM00324	RhoGAP
ProfileScan	IPR001849	67	172	PS50003	Pleckstrin-like
IPR000198	180	374	PS50238	RhoGAP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: Stanford G3
Primer_f	: GCCCCTTTCTCAGTGCTATCT
Primer_r	: TCTCTGCTCACCCTCACCTTC
PCR product length	: 134 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	629 bp
Genome contig ID	gi89161199f_68755624
PolyA signal sequence (AATAAA,-15)	+--------+--------+----*----+---- TGATGAGAAAATTATATTCAAATAAAGCAAAATTT
Flanking genome sequence (151837 - 151886)	----+--------+--------+--------+--------+----* AAAAAAAAAAGGCTATTGCTAATCCATACGGCACCTTTGTGAGAATTAGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	68855624	68907459	10	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA0053

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information