HUGE

Gene/Protein Characteristic Table for KIAA0712

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00610
Accession No. :	AB018255
Description :	Rho GTPase-activating protein.
HUGO Gene Name :
Clone Name :	hg04169 [Vector Info]
Flexi ORF Clone :	pF1KSDA0712
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6477 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 960 bp

Genome contig ID gi51511727r_128243052
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CATTGGTTTTCCTAAATTATCAACTTTCTTTCATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAGCCCAGCATGGTTTGACTGGATAGACAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 r 128343052 128399219 13 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1770 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW67738	100.0	Rho GTPase-acti...	Homo sapiens
A7KAX9	100.0	Rho/Cdc42/Rac G...	Homo sapiens
AAO43677	100.0	rac GTPase acti...	Homo sapiens
XP_546401	87.5	similar to Rho ...	Canis lupus fam...
XP_001056872	86.6	similar to Rho ...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033030	3.2e-31	28.6	KIAA1204
AB014572	3.7e-07	24.2	KIAA0672
AB014521	1.5e-06	27.0	KIAA0621
D29642	1.2e-05	26.1	KIAA0053
AB040934	1.4e-05	30.0	KIAA1501

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000198 69 222 PF00620 RhoGAP

HMMSmart IPR000198 66 247 SM00324 RhoGAP

ProfileScan IPR000198 55 250 PS50238 RhoGAP

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000198	69	222	PF00620	RhoGAP
HMMSmart	IPR000198	66	247	SM00324	RhoGAP
ProfileScan	IPR000198	55	250	PS50238	RhoGAP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGTGTTCAGTTAGAGTCGTGG

Primer_r
: CTGAGTCTAAGTGGTCTGGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGTGTTCAGTTAGAGTCGTGG
Primer_r	: CTGAGTCTAAGTGGTCTGGTG
PCR product length	: 146 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	960 bp
Genome contig ID	gi51511727r_128243052
PolyA signal sequence (None)	+--------+--------+----*----+---- CATTGGTTTTCCTAAATTATCAACTTTCTTTCATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAGCCCAGCATGGTTTGACTGGATAGACAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	r	128343052	128399219	13	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0712

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information