HUGE

Gene/Protein Characteristic Table for KIAA0621

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04156
Accession No. :	AB014521
Description :	Rho GTPase-activating protein 26.
HUGO Gene Name :	Rho GTPase activating protein 26 (ARHGAP26)
Clone Name :	hg04539 [Vector Info]
Flexi ORF Clone :	pF1KA0621
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6300 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4038 bp

Genome contig ID gi51511721f_142133178
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGCCTGGGTGACAGAGCCAGACTCCGTCTCAAAGG
Flanking genome sequence
(453067 - 453116)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAGAATGCCATGCCAGGAGAAGACAGCTGGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 142233178 142586243 22 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 753 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UNA1	100.0	Rho GTPase-acti...	Homo sapiens
XP_001154330	99.5	similar to olig...	Pan troglodytes
XP_001154393	99.5	similar to olig...	Pan troglodytes
XP_001096464	99.5	GTPase regulato...	Macaca mulatta
XP_535224	97.9	similar to Rho-...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D26069	1.1e-07	22.9	KIAA0041
AB040911	2.3e-07	31.0	KIAA1478
AB037845	4.1e-07	31.7	KIAA1424
AB018255	6.9e-07	27.0	KIAA0712
AB051509	7.7e-07	28.3	KIAA1722

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001452 700 751 PD000066 Src homology-3

FPrintScan IPR001452 712 727 PR00452 Src homology-3

IPR001452 741 753 PR00452 Src homology-3

HMMPfam IPR001849 205 308 PF00169 Pleckstrin-like

IPR000198 330 486 PF00620 RhoGAP

IPR001452 698 753 PF00018 Src homology-3

HMMSmart IPR001849 205 310 SM00233 Pleckstrin-like

IPR000198 326 504 SM00324 RhoGAP

IPR001452 698 753 SM00326 Src homology-3

ProfileScan IPR001849 204 308 PS50003 Pleckstrin-like

IPR000198 322 507 PS50238 RhoGAP

IPR001452 695 753 PS50002 Src homology-3

ScanRegExp IPR003006 704 710 PS00290 Immunoglobulin/major histocompatibility complex motif

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	700	751	PD000066	Src homology-3
FPrintScan	IPR001452	712	727	PR00452	Src homology-3
IPR001452	741	753	PR00452	Src homology-3
HMMPfam	IPR001849	205	308	PF00169	Pleckstrin-like
IPR000198	330	486	PF00620	RhoGAP
IPR001452	698	753	PF00018	Src homology-3
HMMSmart	IPR001849	205	310	SM00233	Pleckstrin-like
IPR000198	326	504	SM00324	RhoGAP
IPR001452	698	753	SM00326	Src homology-3
ProfileScan	IPR001849	204	308	PS50003	Pleckstrin-like
IPR000198	322	507	PS50238	RhoGAP
IPR001452	695	753	PS50002	Src homology-3
ScanRegExp	IPR003006	704	710	PS00290	Immunoglobulin/major histocompatibility complex motif

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 644 FVWFSVAAVVLSLARSSLHAVFS 666 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	644	FVWFSVAAVVLSLARSSLHAVFS	666	PRIMARY	23

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TATGAGCCAATGAGTAGGAAG

Primer_r
: AAAGGAAACTGGAGGCTACTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TATGAGCCAATGAGTAGGAAG
Primer_r	: AAAGGAAACTGGAGGCTACTG
PCR product length	: 191 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4038 bp
Genome contig ID	gi51511721f_142133178
PolyA signal sequence (None)	+--------+--------+----*----+---- AGCCTGGGTGACAGAGCCAGACTCCGTCTCAAAGG
Flanking genome sequence (453067 - 453116)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAGAATGCCATGCCAGGAGAAGACAGCTGGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	142233178	142586243	22	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0621

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information