HUGE |
Gene/Protein Characteristic Table for KIAA1424 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04154 |
---|---|
Accession No. : | AB037845 |
Description : | Rho GTPase activating protein 21. |
HUGO Gene Name : | Rho GTPase activating protein 21 (ARHGAP21) |
Clone Name : | ha06448 [Vector Info] |
Source : | Human adult brain |
Note : | We replaced hh15972, former representative clones for KIAA1424 with ha06448. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6631 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 794 bp Genome contig ID gi89161187r_24812551 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
CCAATTAAACACTGGAAATAAAAATTGTTTTGGTGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AATTTTGCATGGCTTGAAACTTATTCTGATATATTTTTAGATGTCATCCA
Chr f/r start end exon identity class ContigView(URL based/DAS) 10 r 24912551 25050794 25 99.6 Perfect prediction ContigView(URL based/DAS) 6 r 80829934 80836598 2 97.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1944 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: ACAGTTGGTTTTTAGGGTGCC | |
: ACCTGGAATGACTAAAGAATG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 6 |
: GeneBridge 4 | |
: ACAGTTGGTTTTTAGGGTGCC | |
: ACCTGGAATGACTAAAGAATG | |
: 150 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |