HUGE

Gene/Protein Characteristic Table for KIAA1424

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04154
Accession No. :	AB037845
Description :	Rho GTPase activating protein 21.
HUGO Gene Name :	Rho GTPase activating protein 21 (ARHGAP21)
Clone Name :	ha06448 [Vector Info]
Source :	Human adult brain
Note :	We replaced hh15972, former representative clones for KIAA1424 with ha06448. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6631 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 794 bp

Genome contig ID gi89161187r_24812551
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
CCAATTAAACACTGGAAATAAAAATTGTTTTGGTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATTTTGCATGGCTTGAAACTTATTCTGATATATTTTTAGATGTCATCCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 r 24912551 25050794 25 99.6 Perfect prediction

ContigView(URL based/DAS) 6 r 80829934 80836598 2 97.0 Perfect prediction

Features of the protein sequence	Description

Length: 1944 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q5T5U3	100.0	Rho GTPase-acti...	Homo sapiens
NP_065875	100.0	Rho GTPase acti...	Homo sapiens
AAM22955	99.7	Rho-GTPase acti...	Homo sapiens
EAW86122	99.7	Rho GTPase acti...	Homo sapiens
XP_507699	99.5	Rho GTPase acti...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040934	2.7e-41	48.6	KIAA1501
AB037725	1.1e-09	22.9	KIAA1304
AB007871	1.4e-08	30.6	KIAA0411
AB051509	1.4e-08	28.0	KIAA1722
AB014572	4.1e-08	29.2	KIAA0672

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001478 36 142 PF00595 PDZ/DHR/GLGF

IPR001849 918 1026 PF00169 Pleckstrin-like

IPR000198 1148 1301 PF00620 RhoGAP

HMMSmart IPR001478 44 145 SM00228 PDZ/DHR/GLGF

IPR001849 918 1028 SM00233 Pleckstrin-like

IPR000198 1145 1322 SM00324 RhoGAP

ProfileScan IPR001478 36 145 PS50106 PDZ/DHR/GLGF

IPR001849 917 1026 PS50003 Pleckstrin-like

IPR000198 1133 1325 PS50238 RhoGAP

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001478	36	142	PF00595	PDZ/DHR/GLGF
IPR001849	918	1026	PF00169	Pleckstrin-like
IPR000198	1148	1301	PF00620	RhoGAP
HMMSmart	IPR001478	44	145	SM00228	PDZ/DHR/GLGF
IPR001849	918	1028	SM00233	Pleckstrin-like
IPR000198	1145	1322	SM00324	RhoGAP
ProfileScan	IPR001478	36	145	PS50106	PDZ/DHR/GLGF
IPR001849	917	1026	PS50003	Pleckstrin-like
IPR000198	1133	1325	PS50238	RhoGAP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACAGTTGGTTTTTAGGGTGCC

Primer_r
: ACCTGGAATGACTAAAGAATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACAGTTGGTTTTTAGGGTGCC
Primer_r	: ACCTGGAATGACTAAAGAATG
PCR product length	: 150 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	794 bp
Genome contig ID	gi89161187r_24812551
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CCAATTAAACACTGGAAATAAAAATTGTTTTGGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTTTGCATGGCTTGAAACTTATTCTGATATATTTTTAGATGTCATCCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	r	24912551	25050794	25	99.6	Perfect prediction
ContigView(URL based/DAS)	6	r	80829934	80836598	2	97.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1424

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information