HUGE

Gene/Protein Characteristic Table for KIAA0411

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05598
Accession No. :	AB007871
Description :	SLIT-ROBO Rho GTPase-activating protein 3.
HUGO Gene Name :	SLIT-ROBO Rho GTPase activating protein 3 (SRGAP3)
Clone Name :	hg02120 [Vector Info]
Flexi ORF Clone :	pF1KA0411
Source :	Human adult brain
Note :	We replaced hg02884, former representative clones for KIAA0411 with hg02120. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6213 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3027 bp

Genome contig ID gi89161205r_8899176
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
TTTAAAAAGGCTACAATTAAATTTTAGCCAATGCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTCACCAAATCTTTGCACCTAGTAGATAGATCAATGTAAAAACAAATAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 8999176 9141603 21 99.4 Terminal No-hit

Features of the protein sequence	Description

Length: 1061 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAN57784	100.0	WAVE-associated...	Homo sapiens
XP_590495	99.5	similar to SLIT...	Bos taurus
XP_001495819	99.4	SLIT-ROBO Rho G...	Equus caballus
XP_001097317	99.0	similar to SLIT...	Macaca mulatta
EAW63950	100.0	SLIT-ROBO Rho G...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037725	5.7e-166	68.9	KIAA1304
AB007925	7.1e-117	59.5	KIAA0456
AB032982	1.7e-75	98.3	KIAA1156
D50921	4e-35	46.4	KIAA0131
AB040934	6.8e-10	29.7	KIAA1501

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001452 711 760 PD000066 Src homology-3

FPrintScan IPR001452 723 738 PR00452 Src homology-3

IPR001452 740 749 PR00452 Src homology-3

IPR001452 751 763 PR00452 Src homology-3

HMMPfam IPR001060 8 106 PF00611 Cdc15/Fes/CIP4

IPR000198 482 635 PF00620 RhoGAP

IPR001452 709 763 PF00018 Src homology-3

HMMSmart IPR001060 8 106 SM00055 Cdc15/Fes/CIP4

IPR000198 479 653 SM00324 RhoGAP

IPR001452 709 764 SM00326 Src homology-3

ProfileScan IPR001060 8 73 PS50133 Cdc15/Fes/CIP4

IPR000198 468 656 PS50238 RhoGAP

IPR001452 706 765 PS50002 Src homology-3

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	711	760	PD000066	Src homology-3
FPrintScan	IPR001452	723	738	PR00452	Src homology-3
IPR001452	740	749	PR00452	Src homology-3
IPR001452	751	763	PR00452	Src homology-3
HMMPfam	IPR001060	8	106	PF00611	Cdc15/Fes/CIP4
IPR000198	482	635	PF00620	RhoGAP
IPR001452	709	763	PF00018	Src homology-3
HMMSmart	IPR001060	8	106	SM00055	Cdc15/Fes/CIP4
IPR000198	479	653	SM00324	RhoGAP
IPR001452	709	764	SM00326	Src homology-3
ProfileScan	IPR001060	8	73	PS50133	Cdc15/Fes/CIP4
IPR000198	468	656	PS50238	RhoGAP
IPR001452	706	765	PS50002	Src homology-3

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TGTAGTCGAGAGCTGCATCCG

Primer_r
: TGACTTCCACCTGAGATCCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGTAGTCGAGAGCTGCATCCG
Primer_r	: TGACTTCCACCTGAGATCCTG
PCR product length	: 148 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3027 bp
Genome contig ID	gi89161205r_8899176
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TTTAAAAAGGCTACAATTAAATTTTAGCCAATGCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTCACCAAATCTTTGCACCTAGTAGATAGATCAATGTAAAAACAAATAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	8999176	9141603	21	99.4	Terminal No-hit

Gene/Protein Characteristic Table for KIAA0411

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information