| HUGE |
Gene/Protein Characteristic Table for KIAA0456 |
|
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Mapping | |
| Product ID : | ORK01975 |
|---|---|
| Accession No. : | AB007925 |
| Description : | SLIT-ROBO Rho GTPase-activating protein 2. |
| HUGO Gene Name : | SLIT-ROBO Rho GTPase activating protein 2 (SRGAP2) |
| Clone Name : | hg00633 [Vector Info] |
| Flexi ORF Clone : | pF1KA0456
|
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6305 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1095 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
|---|---|---|
| : 1 |
| : GeneBridge 4 | |
| : CACAACATTGCGATTCCCTGG | |
| : AGGAGATGAGGAGCGGTGATG | |
| : 117 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
