| HUGE |
Gene/Protein Characteristic Table for KIAA0131 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00025 |
|---|---|
| Accession No. : | D50921 |
| Description : | Rho GTPase-activating protein 4. |
| HUGO Gene Name : | Rho GTPase activating protein 4 (ARHGAP4) |
| Clone Name : | ha01235 [Vector Info] |
| Flexi ORF Clone : | pF1KA0131
|
| Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3180 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 350 bp Genome contig ID gi89161218r_152726027 PolyA signal sequence
(CATAAA,-24)
GGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCFlanking genome sequence
(100000 - 99951)
CGATGGGAGCCAGCTCTCTGTCTCGGGTGGGCAGGTGGGTGCTGGAGGTG
Features of the protein sequence |
Description | |
|---|---|---|
Length: 942 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : X |
| : Genebridge 4 | |
| : TAGACACGACCCCCAAGCCAC | |
| : CTGGACAGGGCTGGAGAGAAG | |
| : 117 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
