HUGE

Gene/Protein Characteristic Table for KIAA1391

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00822
Accession No. :	AB037812
Description :	Rho GTPase-activating protein 20.
HUGO Gene Name :	Rho GTPase activating protein 20 (ARHGAP20)
Clone Name :	hh12985 [Vector Info]
Flexi ORF Clone :	pF1KSDA1391
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5901 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2315 bp

Genome contig ID gi51511727r_109852988
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
CCATGCTGTCTGTTAAATAAAATGCCATTCTGCAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATTAACCATCCCACCAGAGCAATATTGCCCTTTGTAGAATTGTTCTAGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 r 109952988 110088174 15 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 1194 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P2F6	100.0	Rho GTPase-acti...	Homo sapiens
AAS45469	100.0	RhoGTPase regul...	Homo sapiens
AAS45470	100.0	RhoGTPase regul...	Homo sapiens
AAS45467	100.0	RhoGTPase regul...	Homo sapiens
XP_522177	99.3	Rho GTPase acti...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D50921	3.1e-10	27.0	KIAA0131
AB007871	4.1e-06	27.9	KIAA0411
AB014572	4.9e-06	26.3	KIAA0672
AB037725	9.2e-06	28.2	KIAA1304
AB007925	2.8e-05	22.3	KIAA0456

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000159 197 286 PF00788 Ras-association

IPR000198 380 530 PF00620 RhoGAP

HMMSmart IPR001849 89 190 SM00233 Pleckstrin-like

IPR000198 377 551 SM00324 RhoGAP

ProfileScan IPR000159 197 298 PS50200 Ras-association

IPR000198 368 554 PS50238 RhoGAP

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000159	197	286	PF00788	Ras-association
IPR000198	380	530	PF00620	RhoGAP
HMMSmart	IPR001849	89	190	SM00233	Pleckstrin-like
IPR000198	377	551	SM00324	RhoGAP
ProfileScan	IPR000159	197	298	PS50200	Ras-association
IPR000198	368	554	PS50238	RhoGAP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACAGCGTTCACTCTCAATATG

Primer_r
: TCTGGCTGACTGTAATCTAAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2315 bp
Genome contig ID	gi51511727r_109852988
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CCATGCTGTCTGTTAAATAAAATGCCATTCTGCAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTAACCATCCCACCAGAGCAATATTGCCCTTTGTAGAATTGTTCTAGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	r	109952988	110088174	15	99.3	Perfect prediction

Primer_f	: ACAGCGTTCACTCTCAATATG
Primer_r	: TCTGGCTGACTGTAATCTAAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1391

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information