HUGE

Gene/Protein Characteristic Table for KIAA1156

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06988
Accession No. :	AB032982
Description :	SLIT-ROBO Rho GTPase-activating protein 3.
HUGO Gene Name :
Clone Name :	hh05667 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5677 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4628 bp

Genome contig ID gi89161205r_8950581
PolyA signal sequence
(AAGAAA,-10)
+----*----+----*----+----*----+----
GGTGACAGGGCAAGACTCCGTCTCAAAGAAAAAGG
Flanking genome sequence
(99534 - 99485)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAGAAAGAAAAGAAAGTGTACTTGACTAAAGAGCAGGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 9050115 9097971 9 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 348 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW63950	7.2e-128	98.3	SLIT-ROBO Rho G...	Homo sapiens
XP_590495	7.8e-128	98.3	similar to SLIT...	Bos taurus
XP_001495819	7.8e-128	98.3	SLIT-ROBO Rho G...	Equus caballus
AAN57784	7.8e-128	98.3	WAVE-associated...	Homo sapiens
XP_869609	7.9e-128	98.3	similar to SLIT...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007871	6e-112	98.3	KIAA0411
AB037725	1.1e-86	76.8	KIAA1304
AB007925	8.3e-68	68.4	KIAA0456
D50921	3.3e-50	47.5	KIAA0131
AB018312	0.00027	26.5	KIAA0769

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGAGATGGAAGGCTTAGGCTG

Primer_r
: ATCTCTGACAAGGAAACGTAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCTCTTCCCACCTGCTACACC
Primer_r	: AATCTGAGCCTGGCCCAAAGC
PCR product length	: 102 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4628 bp
Genome contig ID	gi89161205r_8950581
PolyA signal sequence (AAGAAA,-10)	+--------+--------+----*----+---- GGTGACAGGGCAAGACTCCGTCTCAAAGAAAAAGG
Flanking genome sequence (99534 - 99485)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAGAAAGAAAAGAAAGTGTACTTGACTAAAGAGCAGGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	9050115	9097971	9	99.2	Perfect prediction

Primer_f	: AGAGATGGAAGGCTTAGGCTG
Primer_r	: ATCTCTGACAAGGAAACGTAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1156

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information