HUGE

Gene/Protein Characteristic Table for KIAA1501

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04155
Accession No. :	AB040934
Description :	Rho GTPase-activating protein 23.
HUGO Gene Name :	Rho GTPase activating protein 23 (ARHGAP23)
Clone Name :	hh12863 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 2436 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 228 bp

Genome contig ID gi51511734f_33776678
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GGGGGCCACAGCGCCGGGGACTCAGGAGCGGCCGC
Flanking genome sequence
(143222 - 143271)
----+----*----+----*----+----*----+----*----+----*
AGGGGCCGCTGCCTGGCGCCGTCGCCCCCGAGGCCCCCGGACGCCTCAGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 f 33876678 33919898 19 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 735 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW60514	100.0	hCG2007242, iso...	Homo sapiens
EAW60513	99.7	hCG2007242, iso...	Homo sapiens
XP_001716658	100.0	similar to Rho ...	Homo sapiens
XP_290799	100.0	Rho GTPase acti...	Homo sapiens
Q9P227	100.0	Rho GTPase-acti...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037845	1.5e-48	48.6	KIAA1424
AB037725	1.4e-11	33.0	KIAA1304
AB051509	1.4e-11	28.1	KIAA1722
AB007871	4.5e-11	29.7	KIAA0411
AB007925	6e-10	32.1	KIAA0456

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001849 280 399 PF00169 Pleckstrin-like

IPR000198 511 664 PF00620 RhoGAP

HMMSmart IPR001849 280 401 SM00233 Pleckstrin-like

IPR000198 508 685 SM00324 RhoGAP

ProfileScan IPR001849 279 399 PS50003 Pleckstrin-like

IPR000198 496 688 PS50238 RhoGAP

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	280	399	PF00169	Pleckstrin-like
IPR000198	511	664	PF00620	RhoGAP
HMMSmart	IPR001849	280	401	SM00233	Pleckstrin-like
IPR000198	508	685	SM00324	RhoGAP
ProfileScan	IPR001849	279	399	PS50003	Pleckstrin-like
IPR000198	496	688	PS50238	RhoGAP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CGAAGACTCTCTGGCTTCCAT

Primer_r
: CAGTCCTGCGAGTAATGGCGT

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CGGAGCTACAGCCCATCATTC
Primer_r	: CCAGGTTGAAGGTAGGCAGCC
PCR product length	: 97 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	228 bp
Genome contig ID	gi51511734f_33776678
PolyA signal sequence (None)	+--------+--------+----*----+---- GGGGGCCACAGCGCCGGGGACTCAGGAGCGGCCGC
Flanking genome sequence (143222 - 143271)	----+--------+--------+--------+--------+----* AGGGGCCGCTGCCTGGCGCCGTCGCCCCCGAGGCCCCCGGACGCCTCAGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	33876678	33919898	19	99.9	Perfect prediction

Primer_f	: CGAAGACTCTCTGGCTTCCAT
Primer_r	: CAGTCCTGCGAGTAATGGCGT
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1501

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information