HUGE

Gene/Protein Characteristic Table for KIAA1706

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00892
Accession No. :	AB051493
Description :
HUGO Gene Name :	endonuclease/exonuclease/phosphatase family domain containing 1 (EEPD1)
Clone Name :	fj17179 [Vector Info]
Flexi ORF Clone :	pF1KSDA1706
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4427 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2336 bp

Genome contig ID gi89161213f_36059620
PolyA signal sequence
(ATTAAA,-31)
+----*----+----*----+----*----+----
TTATATTAAAGTTCACTCTTTGTGTTGTGCATCCT
Flanking genome sequence
(248058 - 248107)
----+----*----+----*----+----*----+----*----+----*
ATGGGTTTTGACAAATGTAGAATGACATGTATCACCATGCTACAGAATCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 f 36159620 36307676 8 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 573 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_085139	0	99.8	endonuclease/ex...	Homo sapiens
XP_001103689	0	98.4	hypothetical pr...	Macaca mulatta
XP_001501241	0	94.0	similar to endo...	Equus caballus
Q3MHJ7	0	93.2	Endonuclease/ex...	Bos taurus
Q5XI74	1e-216	91.0	Endonuclease/ex...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000445 42 71 PF00633 Helix-hairpin-helix motif

IPR005135 265 542 PF03372 Endonuclease/exonuclease/phosphatase

HMMSmart IPR003583 52 71 SM00278 Helix-hairpin-helix DNA-binding

IPR003583 82 101 SM00278 Helix-hairpin-helix DNA-binding

IPR003583 149 168 SM00278 Helix-hairpin-helix DNA-binding

HMMTigr IPR004509 42 104 TIGR00426 Competence protein ComEA helix-hairpin-helix region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000445	42	71	PF00633	Helix-hairpin-helix motif
IPR005135	265	542	PF03372	Endonuclease/exonuclease/phosphatase
HMMSmart	IPR003583	52	71	SM00278	Helix-hairpin-helix DNA-binding
IPR003583	82	101	SM00278	Helix-hairpin-helix DNA-binding
IPR003583	149	168	SM00278	Helix-hairpin-helix DNA-binding
HMMTigr	IPR004509	42	104	TIGR00426	Competence protein ComEA helix-hairpin-helix region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACCCTTGTTAACCTTCACCTG

Primer_r
: TCATAGTCATTGCTGTCTGGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2336 bp
Genome contig ID	gi89161213f_36059620
PolyA signal sequence (ATTAAA,-31)	+--------+--------+----*----+---- TTATATTAAAGTTCACTCTTTGTGTTGTGCATCCT
Flanking genome sequence (248058 - 248107)	----+--------+--------+--------+--------+----* ATGGGTTTTGACAAATGTAGAATGACATGTATCACCATGCTACAGAATCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	f	36159620	36307676	8	99.4	Perfect prediction

Primer_f	: ACCCTTGTTAACCTTCACCTG
Primer_r	: TCATAGTCATTGCTGTCTGGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1706

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information