HUGE |
Gene/Protein Characteristic Table for KIAA1713 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04196 |
---|---|
Accession No. : | AB051500 |
Description : | additional sex combs like 3 (Drosophila) (ASXL3), mRNA. |
HUGO Gene Name : | |
Clone Name : | fh22344 [Vector Info] |
Source : | Human fetal brain |
Note : | We replaced fj19009, former representative clones for KIAA1713 with fh22344. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5779 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 818 bp Genome contig ID gi51511735f_29473153 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TAGAGCTTCATGTGTGGCTTTTAAGAGCAGGTTTGFlanking genome sequence
(108224 - 108273) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAGACCCTAAACTTCAAAGCAAGGAAATAAGATGCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 18 f 29573153 29581375 2 99.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1652 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AATGAAATCCACTGTCCTGAG | |
: TATTATCAGGTGTCAAAGGCC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 18 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |