HUGE

Gene/Protein Characteristic Table for KIAA1717

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00270
Accession No. :	AB051504
Description :	Histone-lysine N-methyltransferase, H3 lysine-4 specific SET7.
HUGO Gene Name :	SET domain containing (lysine methyltransferase) 7 (SETD7)
Clone Name :	pf00208 [Vector Info]
Flexi ORF Clone :	pF1KA1717
Source :	Human brain (hippocampus)

Features of the cloned DNA sequence	Description

Length: 6992 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5624 bp

Genome contig ID gi89161207r_140546643
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
AGAAACAATGCAAGTATTAAACAAAATATACAATC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATCTGTCATTGTCTTCCTTTGGTCATCTAGGTTAGAAAAGCAATAATGGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 r 140646643 140697008 8 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 420 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001088778	4.7e-145	99.0	similar to SET ...	Macaca mulatta
Q8WTS6	2.1e-125	100.0	Histone-lysine ...	Homo sapiens
XP_533287	5.9e-123	90.3	similar to SET ...	Canis lupus fam...
XP_001138145	1.4e-121	89.8	SET domain-cont...	Pan troglodytes
EDM14980	2e-121	95.9	rCG49977, isofo...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003409 90 112 PF02493 MORN motif

IPR003409 113 135 PF02493 MORN motif

IPR003409 160 182 PF02493 MORN motif

IPR001214 266 397 PF00856 SET

HMMSmart IPR001214 268 396 SM00317 SET

ProfileScan IPR001214 269 394 PS50280 SET

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003409	90	112	PF02493	MORN motif
IPR003409	113	135	PF02493	MORN motif
IPR003409	160	182	PF02493	MORN motif
IPR001214	266	397	PF00856	SET
HMMSmart	IPR001214	268	396	SM00317	SET
ProfileScan	IPR001214	269	394	PS50280	SET

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAAAAGTTAACCCCATCACGG

Primer_r
: TCATGCACCCAGACACACTAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	5624 bp
Genome contig ID	gi89161207r_140546643
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- AGAAACAATGCAAGTATTAAACAAAATATACAATC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCTGTCATTGTCTTCCTTTGGTCATCTAGGTTAGAAAAGCAATAATGGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	r	140646643	140697008	8	99.2	Perfect prediction

Primer_f	: CAAAAGTTAACCCCATCACGG
Primer_r	: TCATGCACCCAGACACACTAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1717

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information