HUGE

Gene/Protein Characteristic Table for KIAA1729

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07485
Accession No. :	AB051516
Description :
HUGO Gene Name :	zinc finger protein 518B (ZNF518B)
Clone Name :	pg00954 [Vector Info]
Source :	Human brain (hippocampus)

Features of the cloned DNA sequence	Description

Length: 6295 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3231 bp

Genome contig ID gi89161207r_9950603
PolyA signal sequence
(AATAAA,-32)
+----*----+----*----+----*----+----
TTAAATAAAGCAACAAAAATTTTCTTTGCCCTTTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTCAAACGTTATGCAGGTGACTTTATTACATAGCCTATTTGTATTATA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 r 10050603 10056889 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 1020 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW92691	99.9	hCG2026767 [Hom...	Homo sapiens
Q9C0D4	99.8	Zinc finger pro...	Homo sapiens
XP_001098027	95.9	similar to plei...	Macaca mulatta
XP_001501034	80.8	zinc finger pro...	Equus caballus
NP_001124305	80.3	zinc finger pro...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002333	8.4e-08	24.5	KIAA0335

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007087 136 159 PF00096 Zinc finger

HMMSmart IPR015880 81 103 SM00355 Zinc finger

IPR015880 108 130 SM00355 Zinc finger

IPR015880 136 159 SM00355 Zinc finger

IPR015880 982 1004 SM00355 Zinc finger

ProfileScan IPR007087 108 135 PS50157 Zinc finger

ScanRegExp IPR007087 984 1004 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	136	159	PF00096	Zinc finger
HMMSmart	IPR015880	81	103	SM00355	Zinc finger
IPR015880	108	130	SM00355	Zinc finger
IPR015880	136	159	SM00355	Zinc finger
IPR015880	982	1004	SM00355	Zinc finger
ProfileScan	IPR007087	108	135	PS50157	Zinc finger
ScanRegExp	IPR007087	984	1004	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGTTTTGTGGGCGACTGTATG

Primer_r
: ACTGAATCTTGGTGGAGGGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3231 bp
Genome contig ID	gi89161207r_9950603
PolyA signal sequence (AATAAA,-32)	+--------+--------+----*----+---- TTAAATAAAGCAACAAAAATTTTCTTTGCCCTTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTCAAACGTTATGCAGGTGACTTTATTACATAGCCTATTTGTATTATA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	r	10050603	10056889	1	99.0	Perfect prediction

Primer_f	: GGTTTTGTGGGCGACTGTATG
Primer_r	: ACTGAATCTTGGTGGAGGGAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1729

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information