HUGE |
Gene/Protein Characteristic Table for KIAA0335 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01665 |
---|---|
Accession No. : | AB002333 |
Description : | Zinc finger protein 518. |
HUGO Gene Name : | zinc finger protein 518A (ZNF518A) |
Clone Name : | pf00495 [Vector Info] |
Flexi ORF Clone : | pF1KA0335
![]() |
Source : | Human brain (hippocampus) |
Note : | We replaced hg01070, former representative clones for KIAA0335 with pf00495. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 8147 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2864 bp Genome contig ID gi89161187f_97805150 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
GTTAGCCAATTTTTTCAATAAAGGGTCAGATAAATFlanking genome sequence
(108236 - 108285) ----+----*----+----*----+----*----+----*----+----*
AAGCTTCGTAGGCCTTCTAGTTTCTGTCCTAACTACTCAATTCTCATAAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 10 f 97905090 97913384 2 99.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1484 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: CATTTGGGGACCTACTGTTAC | |
: TTCAGTTTAGTTCAGTGCATG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 10 |
: GeneBridge 4 | |
: CATTTGGGGACCTACTGTTAC | |
: TTCAGTTTAGTTCAGTGCATG | |
: 222 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |