HUGE

Gene/Protein Characteristic Table for KIAA0335

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01665
Accession No. :	AB002333
Description :	Zinc finger protein 518.
HUGO Gene Name :	zinc finger protein 518A (ZNF518A)
Clone Name :	pf00495 [Vector Info]
Flexi ORF Clone :	pF1KA0335
Source :	Human brain (hippocampus)
Note :	We replaced hg01070, former representative clones for KIAA0335 with pf00495. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 8147 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2864 bp

Genome contig ID gi89161187f_97805150
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
GTTAGCCAATTTTTTCAATAAAGGGTCAGATAAAT
Flanking genome sequence
(108236 - 108285)
----+----*----+----*----+----*----+----*----+----*
AAGCTTCGTAGGCCTTCTAGTTTCTGTCCTAACTACTCAATTCTCATAAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 f 97905090 97913384 2 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 1484 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6AHZ1	100.0	Zinc finger pro...	Homo sapiens
CAH10523	99.9	hypothetical pr...	Homo sapiens
XP_001100415	96.0	similar to zinc...	Macaca mulatta
XP_001501837	85.0	similar to Zinc...	Equus caballus
XP_001928172	83.3	similar to Zinc...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051516	7.6e-09	24.0	KIAA1729
AB075862	8.5e-06	24.7	KIAA1982
AB058732	1.5e-05	28.6	KIAA1829
AB075849	1.7e-05	23.6	KIAA1969
AB007886	1.7e-05	23.8	KIAA0426

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007087 263 286 PF00096 Zinc finger

HMMSmart IPR015880 120 145 SM00355 Zinc finger

IPR015880 151 173 SM00355 Zinc finger

IPR015880 178 202 SM00355 Zinc finger

IPR015880 208 230 SM00355 Zinc finger

IPR015880 235 257 SM00355 Zinc finger

IPR015880 263 286 SM00355 Zinc finger

IPR015880 1450 1472 SM00355 Zinc finger

ProfileScan IPR007087 235 262 PS50157 Zinc finger

IPR007087 1450 1477 PS50157 Zinc finger

ScanRegExp IPR007087 237 257 PS00028 Zinc finger

IPR007087 1452 1472 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	263	286	PF00096	Zinc finger
HMMSmart	IPR015880	120	145	SM00355	Zinc finger
IPR015880	151	173	SM00355	Zinc finger
IPR015880	178	202	SM00355	Zinc finger
IPR015880	208	230	SM00355	Zinc finger
IPR015880	235	257	SM00355	Zinc finger
IPR015880	263	286	SM00355	Zinc finger
IPR015880	1450	1472	SM00355	Zinc finger
ProfileScan	IPR007087	235	262	PS50157	Zinc finger
IPR007087	1450	1477	PS50157	Zinc finger
ScanRegExp	IPR007087	237	257	PS00028	Zinc finger
IPR007087	1452	1472	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CATTTGGGGACCTACTGTTAC

Primer_r
: TTCAGTTTAGTTCAGTGCATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CATTTGGGGACCTACTGTTAC
Primer_r	: TTCAGTTTAGTTCAGTGCATG
PCR product length	: 222 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2864 bp
Genome contig ID	gi89161187f_97805150
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GTTAGCCAATTTTTTCAATAAAGGGTCAGATAAAT
Flanking genome sequence (108236 - 108285)	----+--------+--------+--------+--------+----* AAGCTTCGTAGGCCTTCTAGTTTCTGTCCTAACTACTCAATTCTCATAAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	f	97905090	97913384	2	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0335

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information