HUGE

Gene/Protein Characteristic Table for KIAA1740

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04525
Accession No. :	AB051527
Description :	Cat eye syndrome critical region protein 2.
HUGO Gene Name :	cat eye syndrome chromosome region, candidate 2 (CECR2)
Clone Name :	pj00674 [Vector Info]
Source :	Human brain (hippocampus)

Features of the cloned DNA sequence	Description

Length: 3837 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 475 bp

Genome contig ID gi89161203f_16283223
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CCAGTTTACAGAATTTTCATGTTGCCTTTTAAAAT
Flanking genome sequence
(129794 - 129843)
----+----*----+----*----+----*----+----*----+----*
AATTTTTGTTGGTGGTGAATGTATTGTACATAAAGTGGGAAGGGTGGGTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 22 f 16383223 16413015 11 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1119 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAH56212	99.7	hypothetical pr...	Homo sapiens
EAW57756	99.9	hCG21538, isofo...	Homo sapiens
EAW57755	97.9	hCG21538, isofo...	Homo sapiens
Q9BXF3	98.2	Cat eye syndrom...	Homo sapiens
EAW57757	99.8	hCG21538, isofo...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001487 89 102 PR00503 Bromodomain

IPR001487 103 119 PR00503 Bromodomain

IPR001487 119 137 PR00503 Bromodomain

IPR001487 137 156 PR00503 Bromodomain

HMMPfam IPR001487 75 161 PF00439 Bromodomain

HMMSmart IPR001487 71 175 SM00297 Bromodomain

ProfileScan IPR001487 86 156 PS50014 Bromodomain

ScanRegExp IPR001487 91 148 PS00633 Bromodomain

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001487	89	102	PR00503	Bromodomain
IPR001487	103	119	PR00503	Bromodomain
IPR001487	119	137	PR00503	Bromodomain
IPR001487	137	156	PR00503	Bromodomain
HMMPfam	IPR001487	75	161	PF00439	Bromodomain
HMMSmart	IPR001487	71	175	SM00297	Bromodomain
ProfileScan	IPR001487	86	156	PS50014	Bromodomain
ScanRegExp	IPR001487	91	148	PS00633	Bromodomain

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTAACTTCTCCAACCCGTATG

Primer_r
: AGATACTCGCTGGCTGACAAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 22

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	475 bp
Genome contig ID	gi89161203f_16283223
PolyA signal sequence (None)	+--------+--------+----*----+---- CCAGTTTACAGAATTTTCATGTTGCCTTTTAAAAT
Flanking genome sequence (129794 - 129843)	----+--------+--------+--------+--------+----* AATTTTTGTTGGTGGTGAATGTATTGTACATAAAGTGGGAAGGGTGGGTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	22	f	16383223	16413015	11	100.0	Perfect prediction

Primer_f	: TTAACTTCTCCAACCCGTATG
Primer_r	: AGATACTCGCTGGCTGACAAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1740

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information