HUGE |
Gene/Protein Characteristic Table for KIAA1740 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04525 |
---|---|
Accession No. : | AB051527 |
Description : | Cat eye syndrome critical region protein 2. |
HUGO Gene Name : | cat eye syndrome chromosome region, candidate 2 (CECR2) |
Clone Name : | pj00674 [Vector Info] |
Source : | Human brain (hippocampus) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3837 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 475 bp Genome contig ID gi89161203f_16283223 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CCAGTTTACAGAATTTTCATGTTGCCTTTTAAAATFlanking genome sequence
(129794 - 129843) ----+----*----+----*----+----*----+----*----+----*
AATTTTTGTTGGTGGTGAATGTATTGTACATAAAGTGGGAAGGGTGGGTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 22 f 16383223 16413015 11 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1119 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TTAACTTCTCCAACCCGTATG | |
: AGATACTCGCTGGCTGACAAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 22 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |