HUGE

Gene/Protein Characteristic Table for KIAA1745

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06762
Accession No. :	AB051532
Description :	Semaphorin-4B precursor.
HUGO Gene Name :	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B (SEMA4B)
Clone Name :	pj01678 [Vector Info]
Flexi ORF Clone :	pF1KA1745
Source :	Human brain (hippocampus)

Features of the cloned DNA sequence	Description

Length: 3766 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1015 bp

Genome contig ID gi51511731f_88445578
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
GTCATTTTTTAATAAAGTCTGAAGAATTACTGTTT
Flanking genome sequence
(128318 - 128367)
----+----*----+----*----+----*----+----*----+----*
AATCCTGGCTCTTCCTCTTCAAGGACAGTTGCTTTTTGAGGTAGGTCTAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 f 88545578 88573894 14 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 893 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001096618	96.7	semaphorin 4B [...	Macaca mulatta
BAG11357	100.0	semaphorin-4B p...	synthetic construct
AAQ88758	99.9	semaphorin C [H...	Homo sapiens
BAF82680	99.8	unnamed protein...	Homo sapiens
Q9NPR2	100.0	Semaphorin-4B; ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051526	2.6e-60	40.3	KIAA1739
AB046839	5.7e-52	38.5	KIAA1619
AB002329	9.8e-29	30.6	KIAA0331
AB040878	3.8e-16	33.1	KIAA1445
AB037789	7.4e-16	32.5	KIAA1368

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001627 126 563 PF01403 Semaphorin/CD100 antigen

IPR002165 581 633 PF01437 Plexin

HMMSmart IPR001627 126 563 SM00630 Semaphorin/CD100 antigen

IPR003659 581 635 SM00423 Plexin/semaphorin/integrin

ProfileScan IPR001627 103 579 PS51004 Semaphorin/CD100 antigen

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001627	126	563	PF01403	Semaphorin/CD100 antigen
IPR002165	581	633	PF01437	Plexin
HMMSmart	IPR001627	126	563	SM00630	Semaphorin/CD100 antigen
IPR003659	581	635	SM00423	Plexin/semaphorin/integrin
ProfileScan	IPR001627	103	579	PS51004	Semaphorin/CD100 antigen

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 772 KEFLVMCTLFVLAVLLPVLFLLY 794 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	772	KEFLVMCTLFVLAVLLPVLFLLY	794	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAATGTACGCCTTTCCCTCAG

Primer_r
: GCAGTTAGTTCCTCGTGTTTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1015 bp
Genome contig ID	gi51511731f_88445578
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- GTCATTTTTTAATAAAGTCTGAAGAATTACTGTTT
Flanking genome sequence (128318 - 128367)	----+--------+--------+--------+--------+----* AATCCTGGCTCTTCCTCTTCAAGGACAGTTGCTTTTTGAGGTAGGTCTAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	f	88545578	88573894	14	100.0	Perfect prediction

Primer_f	: CAATGTACGCCTTTCCCTCAG
Primer_r	: GCAGTTAGTTCCTCGTGTTTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1745

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information